Báo cáo khoa học: " SemiHypofractionated radiotherapy for lung tumors with online cone beam CT guidance and active breathing control" ppt
... 5:19 http://www.ro-journal.com/content/5/1/19 Page 9 of 9 RESEARC H Open Access Hypofractionated radiotherapy for lung tumors with online cone beam CT guidance and active breathing control Yali Shen 1 , Hong Zhang 1 , Jin Wang 1 , ... Xu 1* Abstract Background: To study the set-up errors, PTV margin and toxicity of cone beam CT (CBCT) guided hypofractionated...
Ngày tải lên: 09/08/2014, 08:22
... tumor tissue and the surrounding collapsed parenchyma. This choice calls for perfect tomographic acquisition with rapid injection of the contrast medium and a first series of slices per- formed immediately ... not for citation purposes) physicians. For gross tumor volume calculation, delinea- tion was performed with the ECLIPSE ® software from VARIAN with the electronic curso...
Ngày tải lên: 09/08/2014, 10:20
... SA: Predictors of biochemical outcome with salvage conformal radiotherapy after radical prostatectomy for prostate can- cer. J Clin Oncol 2003, 21:483-489. 34. Partin AW, Pearson JD, Landis PK, ... associated with prognosis. BNED/3-years for patients submitted to radiotherapy including seminal vesicle bed was 81.64% versus 61.5% for patients submitted to radiotherapy to prosta...
Ngày tải lên: 09/08/2014, 10:21
Tài liệu Báo cáo khoa học: "Co-training for Predicting Emotions with Spoken Dialogue Data" pdf
... Emo_Learner.Predict(predict) ne_Predictions = NE_Learner.Predict(predict) emo_sorted_Predictions = Sort_by_confidence( emo_Predictions) ne_sorted_Predictions = Sort_by_confidence( ne_Predictions) ... Precision of Non-Emotional with all features and best feature for NPV using Naïve Bayes (used for Feature Selection) and AdaBoost- j48 Decision Trees (used for Co-traini...
Ngày tải lên: 20/02/2014, 16:20
Báo cáo khoa học: "A Corpus for Modeling Morpho-Syntactic Agreement in Arabic: Gender, Number and Rationality" docx
... The corresponding IAA scores for all words (including words with unknown lemmas) drop to 86.8%, 94.9% and 82.9% (for types) and 93.5%, 99.2% and 94.0% (for tokens). The respective Kappa values for types are ... both in form and function. In 91.4% of all nomi- nals, function and form agree. Adjectives show the most agreement (98.8%) followed by nouns (92.5%) and then prope...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: "Variational Inference for Grammar Induction with Prior Knowledge" pdf
... results with our method only for the logistic normal prior. We do inference on sections 1–270 and 301–1151 of CTB10 (4,909 sentences) by running the EM al- gorithm for 20 iterations, for which ... Following stan- dard practice, sentences were stripped of words and punctuation, leaving part-of-speech tags for the unsupervised induction of dependency struc- ture, and sentences o...
Ngày tải lên: 08/03/2014, 01:20
Báo cáo khoa học: "A System for Detecting Subgroups in Online Discussions" pptx
... open source and is freely available for download. An online demo of the system is available at: http://clair.eecs.umich.edu/SubgroupDetector/ 1 Introduction Online forums discussing ideological and political topics ... expected format. However, the sys- tem package comes with two such parsers for two different discussion sites: www.politicalforum.com and www.createdebate.com....
Ngày tải lên: 16/03/2014, 20:20
Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt
... tatagatctctcacttcttcttttactatc). The PCR product was subcloned into a pQE60 vector using NcoI and BglII sites to introduce a C-terminal His 6 -Tag. The NcoI–HindIII fragment of this vector was ... protein with inhibitor 1, or without any ligand. As shown in Fig. 3, in the absence of ligands the electrophoretic mobility in native PAGE was slightly higher for the holo-form than for the...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo khoa học: "Pattern Learning for Relation Extraction with a Hierarchical Topic Model" pptx
... seed list selections. Results show that the learned patterns can be used to extract new relations with good preci- sion. 1 Introduction The detection of relations between entities for the automatic ... usually defined manually and may need to be adapted to dif- ferent languages and domains. Manually selected seeds can also be used (Ravichandran and Hovy, 2002; Kozareva and Hovy, 20...
Ngày tải lên: 30/03/2014, 17:20
Báo cáo khoa học: "Generative Models for Statistical Parsing with Combinatory Categorial Grammar" pptx
... in the direction of the sister changes, with a probability of P ∆ L H ∆ L P H#P S if exp , and analo- gously for exp . ∆ L S and ∆ R S are conditioned on S and the ∆ of H and P in the direction of ... cap- ture the fact that, for a sentence without extraction, a CCG derivation where the subject is type-raised and composed with the verb is much more likely in right node raisi...
Ngày tải lên: 31/03/2014, 06:20