Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf
Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf
... only. The inhibitory effect of catecholamines on IFN-γ production was lower in RA patients as compared with HDs. In RA patients, a catecholamine-induced shift toward a Th2 (type 2) polarised cytokine ... RA patients and HDs. RA patients demonstrate an impaired inhibitory effect of catecholamines on IFN-γ production together with a failure to induce a...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo khoa học: " Comparison of rectal volume definition techniques and their influence on rectal toxicity in patients with prostate cancer treated with 3D conformal radiotherapy: a dose-volume analysis" ppt
... hospital admission; grade 4 = symptoms necessitating a major sur- gical procedure (laparatomy, colostomy, long stay in hos- pital); and grade 5 = death. Grades 1 and 2 rectal bleeding is defined as incidental ... analysis Cem Onal*, Erkan Topkan † , Esma Efe † , Melek Yavuz † , Serhat Sonmez † and Aydin Yavuz † Address: Department of Radiation Oncology, Baskent University Medical Facu...
Ngày tải lên: 09/08/2014, 09:22
Báo cáo y học: "Comparison between partial ulnar and intercostal nerve transfers for reconstructing elbow flexion in patients with upper brachial plexus injurie" pot
... Medicine, Kyoto University, 54 Shougoin Kawahara-cho, Sakyo-ku, Kyoto 606-8507, Japan. 2 Department of Rehabilitation Medicine, Kyoto University Hospital 54 Shougoin Kawahara-cho, Sakyo-ku, Kyoto ... SD was blind to the patients and analyzed the preoperative and postoperative data to draw the conclusions. TK performed personal and financial management in the study. All authors read...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot
... thermodynamics of binding of Yb 3+ to apoTf. Binding of Yb 3+ to apo-Tf was investigated by addition of aliquots of Yb 3+ to a solution of apo-TF in 100 m M Hepes buffer in the presence of 5 m M NaHCO 3 . ... complex of lactoferrin with a lanthanide ion (Sm 3+ )at3. 4A ˚ resolution. Acta Crystallogr. D55, 1799–1804. 36. Kitamura, T., Gatmaitan, Z. & Arias,...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: Oxidation of propionate to pyruvate in Escherichia coli Involvement of methylcitrate dehydratase and aconitase pot
... Forward primer Acs 5¢- TAATACGACTCACTATAGGGA*5¢-AACACACCATTCCTGCCAAC-3¢ CCACCACAGGTCGCGCC-3¢ AcnB 5¢- TAATACGACTCACTATAGGGA*5¢-CTCACACGCTGCTGATGTTC-3¢ CGTGGTTACGCACTTCACC-3¢ PrpD 5¢- TAATACGACTCACTATAGGGA*5¢-AACATCGGCGCGATGATCC-3¢ TCGCTGCTTCAACTGCCG-3 PrpE ... pyroglutamic acid formation at the N-terminal glutamine, and modifica- tion of cysteine by carbamidomethylation as well as partial cl...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Contribution of Lys276 to the conformational flexibility of the active site of glutamate decarboxylase from Escherichia coli pptx
... not to be involved in reprotonation after decarboxylation, but mainly to play a role in the initial transaldimination, in proper positioning of the a- carb- oxylate for decarboxylation and in product ... activity and are attributed to protona- tion of the internal aldimine formed with lysine and the cofactor aldehyde. For example, aspartate aminotransferase is converted...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo y học: "Transition of healthy to diseased synovial tissue in rheumatoid arthritis is associated with gain of mesenchymal/fibrotic characteristics" pdf
... 5'-CAGGCGCATGAAGGCAAGTTGGGTAG-3' α-sma 5'-CGTGTTGCCCCTGAAGAGCAT-3' 5'-ACCGCCTGGATAGCCACATACA-3' TLH 5'-TTAAAGGAAAGACACTCCGATCAGAGATGA-3' 5'-AATGTTTCCGGAGTAGGGGAGTCTTTTT-3' β 2 M ... tissueHaematoxylin and eosin staining on healthy and arthritic synovial tissue. Haematoxylin and eosin staining was performed on synovial biopsies from (a) healt...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: " Predictors of adherence to antiretroviral therapy among people living with HIV/AIDS in resourcelimited setting of southwest ethiopia" pdf
... CDC stage C patien ts had higher risk of pharmacy non-adherence than a symptomatic patients. When compared with asymptomatic patients, themultivariateanalysisconfirmedamarkedriskof non-adherence ... history of hospitali- zation), adherence to treatment information, symptoms associated with treatment. To identify clinical markers medical record was reviewed. Data analysis and...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Validation of actigraphy to assess circadian organization and sleep quality in patients with advanced lung cancer" potx
... and quantity parameters as well as daily activity of healthy individuals [11-15]. Care has been taken to fully specify the instrumentation type, sampling mode and analysis tools in order to allow inclusion ... VAMC patients as outpatients. Actigraphic data of healthy controls were obtained from the A mbulatory Monitor- ing, Inc (AMI) database. Presence and severity of COPD was...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: " Effect of Weight Reduction on Cardiovascular Risk Factors and CD34-positive Cells in Circulatio"
... reagent to check the non-specific binding of the CD34-PE monoclonal antibody. Statistical analysis All data were analyzed by Systat software (Sys- tat Inc) and KaleidaGraph software. Variables ... days prior to beginning a 36-day very low calorie diet. This was followed by a 35 day maintenance period during which calorie in- take was gradually raised while restricting sugar a...
Ngày tải lên: 25/10/2012, 10:51