Báo cáo khoa học: "Upper abdominal body shape is the risk factor for postoperative pancreatic fistula after splenectomy for advanced gastric cancer: A retrospective study" ppsx

... through the drains once or twice a day. Definition of Postoperative Pancreatic Fistula (POPF) A case of POPF had to satisfy the criteria for the postoper- ative pancreatic fistula after pancreaticoduodenectomy: Output ... dissection is pancreatic fistula [3,5-7]. European clinical trials have shown that pancreatic com- plications are a major cause of mortalit...

Ngày tải lên: 09/08/2014, 07:21

... crown ratio, leaf biomass and leaf area decreased sig- nificantly with an increase in density. However, crown shape ratio, leaf area projection and leaf area ratio did ... parameters measured at harvesting and nutri- ent content data, except that the repeated measurement component (γ n) was excluded. Linear regression analysis of SLA ....

Ngày tải lên: 08/08/2014, 14:21

... T, et al: In situ surgical procedures for locally advanced pancreatic cancer: partial abdominal evisceration and intestinal autotransplantation. J Hepatobiliary Pancreat Surg 2009, 16:771-776. 23. ... were pancreatic head fibroma, vascular malformation at the mesenteric root, desmoid tumor of the pancreatic tail, and local ly advanced pancreatic ade- nocarcinoma [ 20,21]...

Ngày tải lên: 09/08/2014, 01:24

... routine. Materials and methods The hospital Austin Health is a university-affiliated teaching hospital with three hospital campuses situated in Melbourne, Australia. The Austin Hospital is the acute care ... raise questions about the appropriate frequency and methods of observation in at -risk hospital patients, reinforce the need for adequately trained medical staff to be...

Ngày tải lên: 25/10/2012, 10:45

... calculator is an important skill for students. As they grow and progress through their education. • They will learn advanced math skills that certainly require them to use a calculator . • A ... can help anyone use the device and solve mathematical problems . • I have organized exams : “Excellent students use scientific calculators to solve mathematical problems ” Therefo...

Ngày tải lên: 21/10/2013, 16:11

... Williston, VT, USA). Image data were statisti- cally quantified by repeated-measures analysis of variance with Bonferroni post-hoc analysis. Acknowledgements We thank Dr N. Cowan (NYU Medical Center) ... domain (KIND) was determined to be a putative signaling domain based on bioinformatic analysis of the N-ter- minal sequence of the Drosophila protein Spir, an actin-nucleation factor [...

Ngày tải lên: 14/02/2014, 19:20

... Horse- radish peroxidase-conjugated antibody against caspase-3 (#610325) was from BD Pharmigen, and antibody against b-actin (A5 441) was from Sigma. Statistical analysis All data are expressed as the ... unsaturated FFAs into the cells. After their internalization, FFAs are converted to fatty acyl-CoA, a reaction catalyzed by ACS. Fatty acyl-CoAs are acti- vated forms of fatty acids...

Ngày tải lên: 14/02/2014, 22:20

... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho- ribosyltransferases is examined using saturation muta- genesis, functional analysis, and ... methylation of GPR150, ITGA8 and HOXD11 in ovarian cancers. Life Sci 80, 1458–1465. 9 Suzuki E, Imoto I, Pimkhaokham A, Nakagawa T, Kamata N, Kozaki KI, Amagasa T & Inazawa J (2007) PRT...

Ngày tải lên: 15/02/2014, 01:20

... 3¢-RACE Zf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACE Zf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACE Zf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACE Zf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACE Zf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACE Zf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACE Zf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACE Zffoxp3-F1 GGAACACACAGAGGGGATGATA Initial...

Ngày tải lên: 16/02/2014, 09:20

... taken and analysed using a confocal microscope (Zeiss LSM510 Meta Confocal Imag- ing System, Jena, Germany). For the statistical analysis to determine the ratio between intracellular and extracellular bacteria ... bioterror- ism. Science 283, 1279–1282. 3 Chanteau S, Ratsitorahina M, Rahalison L, Rasoama- nana B, Chan F, Boisier P, Rabeson D & Roux J (2000) Current epidemiology of...

Ngày tải lên: 16/02/2014, 15:20