Báo cáo y học: "To keep the catch – that is the question: a personal account of the 3rd Annual EULAR Congress, Stockholm" potx

Báo cáo y học: "To keep the catch – that is the question: a personal account of the 3rd Annual EULAR Congress, Stockholm" potx

Báo cáo y học: "To keep the catch – that is the question: a personal account of the 3rd Annual EULAR Congress, Stockholm" potx

... relation to science. Keywords: ACR, EULAR, poster sessions, rheumatology congress, satellite symposia Correspondence To keep the catch – that is the question: a personal account of the 3rd Annual ... Diseases, the official EULAR journal. This now has an impact factor of over 3 and is next only to the ACR journal Arthritis and Rheumatism in its fiel...

Ngày tải lên: 09/08/2014, 06:22

3 296 0
 Báo cáo y học: "980 nm diode lasers in oral and facial practice: current state of the science and art"

Báo cáo y học: "980 nm diode lasers in oral and facial practice: current state of the science and art"

... developing very quickly. It is an instrument that achieves maximum oral health in a minimally invasive fashion. New Lasers with a wide range of characteristics are available today and are being ... 361 had healed without leaving any macroscopically visi- ble scars [Fig.2b,3b], after the appearance for half a day of erythema with moderate serum secretion and microcrasts...

Ngày tải lên: 26/10/2012, 09:48

7 567 1
Báo cáo y học: " High cell density and latent membrane protein 1 expression induce cleavage of the mixed lineage leukemia gene at 11q23 in nasopharyngeal carcinoma cell line" ppt

Báo cáo y học: " High cell density and latent membrane protein 1 expression induce cleavage of the mixed lineage leukemia gene at 11q23 in nasopharyngeal carcinoma cell line" ppt

... spsim@fmhs.unimas.my Faculty of Medicine and Health Sciences, Universiti Malaysia Sarawak, Lot 77, Seksyen 22 KTLD, Jalan Tun Ahmad Zaidi Adruce, 93150 Kuching, Sarawak, Malaysia Yee and Sim Journal of Biomedical Science ... was significantly reduced by caspase inhibitor, Z-DEVD-FMK. Similarly, IPCR analysis showed that LMP1 expression enhanced cleavage of the MLL bcr. Breakpoint an...

Ngày tải lên: 10/08/2014, 05:21

8 387 0
Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

... rpk was calculated. Conclusions The study demonstrates that although aviation is regulated by a variety of national and international laws, standardised documentation of IMEs is inadequate and ... interests. Authors' contributions MS participated in the study design, data analysis and inter- pretation of the data as well as the writing of the manuscript. FGB par...

Ngày tải lên: 25/10/2012, 10:31

6 640 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

... 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢. H1 7A: 5¢-GCATTTTGTTCTGGTACACGGCGGATGTCTCG GAGCTTGG-3¢.H-8 6A: 5¢-GGTTGTTCTTCTTGG CCATAGCTTTGGTGGCATGAGTTTGGG-3¢. ... Bradford reagent [14] using BSA (SERVA, Heidelberg, Germany) as standard. Fig. 1. The major steps of...

Ngày tải lên: 24/03/2014, 04:21

8 345 0
Báo cáo khoa học: Activated transglutaminase from Streptomyces mobaraensis is processed by a tripeptidyl aminopeptidase in the final step pptx

Báo cáo khoa học: Activated transglutaminase from Streptomyces mobaraensis is processed by a tripeptidyl aminopeptidase in the final step pptx

... Pro-Leu-Gly-pNA or Ala-Ala- Phe-pNA for SM-TAP corresponded to that of Ala-Ala- Val-Ala-pNA or Ala-Pro-pNA, exhibiting precisely the sequence of FRAP-TGase. Yellowing of the Ala-Ala-Val-Ala-pNA solution ... the tetrapeptide Ala-Ala-Val-Ala-pNA was revealed. The inability of the peptidase to hydrolyse Ala-Ala-pNA and Ala-pNA (or other chromogenic amino acids) at reason- abl...

Ngày tải lên: 31/03/2014, 07:20

7 480 0
Báo cáo khoa học: "Relation between ecological conditions and fir decline in a sandstone region of the Vosges mountains (northeastern France) Anne-Laure Thomasa, Jean-Cl." potx

Báo cáo khoa học: "Relation between ecological conditions and fir decline in a sandstone region of the Vosges mountains (northeastern France) Anne-Laure Thomasa, Jean-Cl." potx

... normal dis- tribution, D 2 is the Mahalanobis distance. The extent of validity of the discriminantanalysis was also measured with the method of crossed validation [19]. The population of all the ... vegetation, topography, lithology and climate. The mathematical distance used was the Mahalanobis distance. A probability or errone- ous classification measures the r...

Ngày tải lên: 08/08/2014, 14:20

9 308 0
báo cáo khoa học: "Implementing health research through academic and clinical partnerships: a realistic evaluation of the Collaborations for Leadership in Applied Health Research and Care (CLAHRC)" pot

báo cáo khoa học: "Implementing health research through academic and clinical partnerships: a realistic evaluation of the Collaborations for Leadership in Applied Health Research and Care (CLAHRC)" pot

... These cases represent a natural sample of the CLAHRCs as each has planned a different approach to implementa- tion. Sampling is based on a theoretical replication argu- ment; it is anticipated that ... will aim to capture data at critical points in the implementation pathways of tra- cer issues. We plan for data collection and analysis to be iterative and cyclical; checkin...

Ngày tải lên: 10/08/2014, 11:20

12 389 0
Báo cáo y học: "To the Editor: We have diagnosed a patient from Quebec" ppsx

Báo cáo y học: "To the Editor: We have diagnosed a patient from Quebec" ppsx

... what is being called the “French-Canadian AID mutation.” The patient was referred to our clinic at the age of 16 years. He had had chronic cervical lym- phadenopathy since the age of 2 years and ... happened to carry the rare allele. If the new population remains isolated as it expands, as has been the case in parts of Quebec, and especially if there is inbreeding, as...

Ngày tải lên: 08/08/2014, 21:20

2 325 0
Báo cáo khoa học: Copper-containing nitrite reductase fromPseudomonas chlororaphis DSM 50135 Evidence for modulation of the rate of intramolecular electron transfer through nitrite binding to the type 2 copper center pot

Báo cáo khoa học: Copper-containing nitrite reductase fromPseudomonas chlororaphis DSM 50135 Evidence for modulation of the rate of intramolecular electron transfer through nitrite binding to the type 2 copper center pot

... this system. Table 1 gathers several electron transfer constants obtained by cyclic voltammetry in other physiologically relevant systems. These data suggest that the electron transfer between azurin and the ... site is bound by four ligands (His95, His145, Cys136 and Met150 in the Ac. cycloclastes numbering) and the geometry is an axially flattened tetrahedron in green Nir or an...

Ngày tải lên: 07/03/2014, 15:20

9 394 0
w