Báo cáo khoa học: "Lymphangiosis carcinomatosa in squamous cell carcinomas of larynx and hypopharynx – value of conventional evaluation and additional immunohistochemical staining of D2-40" ppsx

... similar to that in Asp141 of Met8P. The idea of NirF being a dehydrogenase is appealing because of the presence of a putative nucleotide-bind- ing motif in the N-terminal of the protein sequence and ... to seek accu- mulation of the substrate of NirF in a mutant that lacks NirF; this too is not trivial as the DnirF strain does not accumulate readily...

Ngày tải lên: 15/02/2014, 01:20

... (2006) Lung adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond to a tyrosine kinase inhibitor or to down-regulation of the receptors. Genes Dev 20, 1496–1510. 5 ... Ito F (2009) Mito- gen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor recepto...

Ngày tải lên: 16/02/2014, 09:20

... compilation ê 2010 FEBS 3173 Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen Christian ... transfected with a full-length furin cDNA, were permeabilized and stained with polyclonal antibodies against furin...

Ngày tải lên: 18/02/2014, 04:20

... versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein Ilaria Sambi 1 , Pietro Gatti-Lafranconi 1 *, Sonia Longhi 2 and Marina Lotti 1 1 Dipartimento ... with a forward primer (5Â-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3Â) designed to introduce a hexahistidine tag and a ClaI restrictio...

Ngày tải lên: 18/02/2014, 04:20

... are also interesting with regards to brain vas- culature, because they regulate the formation and main- tenance of BBB, modulate neurovascular coupling and maintain several parts of brain homeostasis. ... origin [78]. According to the monocyte hypothesis, during embryogenesis, and even in adults, migrating monocytes enter the brain via blood vessels and then differenti...

Ngày tải lên: 18/02/2014, 11:20

... VEGF-D, binds and activates this receptor, resulting in the proliferation and migration of lymph ECs and lymphangiogenesis [13]. Angiogenesis in brain diseases Brain stroke Stroke is induced through: ... among tissues in the body, and the risk of edema to brain functions should be carefully considered. Brain edema may increase pressure in the cranial cavity and...

Ngày tải lên: 18/02/2014, 11:20

... MINIREVIEW Brain angiogenesis in developmental and pathological processes: neurovascular injury and angiogenic recovery after stroke Ken Arai, Guang Jin, Deepti Navaratna and Eng H. ... whether neurovascular responses after stroke can be reinter- preted in the context of angiogenesis in the brain. Is it possible that some of the acute neurovascular...

Ngày tải lên: 18/02/2014, 11:20

... activates adenylate cyclase (CyaA) and leads to an increase in the intra- cellular cyclic AMP (cAMP) level [1]. Mathematical models of catabolite repression in E. coli The (isolated) reactions of the ... key players of catabolite repression. Mathematical modelling of signal transduction and gene expres- sion of the enzymes involved in the transport of carbohydrate...

Ngày tải lên: 18/02/2014, 13:20

... Vitellogenin, in the mosquito Aedes aegypti. Mol Cell Endocrinol 267, 97–105. 20 Velarde RA, Robinson GE & Fahrbach SE (2006) Nuclear receptors of the honey bee: annotation and expression in the ... reorganization of the follicular epithelium in the resulting adults [40]. DmE75A and DmE75B have been implicated in defining the transition stages 8 and 9 o...

Ngày tải lên: 18/02/2014, 13:20

... region including the hydrophobic segment of the C-terminal domain is essential for both the client binding and dimer formation of the HSP90-family molecular chaperone and that the dimeric configuration appears ... C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chap...

Ngày tải lên: 23/03/2014, 20:22

... evaluation of staining, manuscript. IN was involved in the evaluation of staining, results. MS, RH, CV were involved in clinical data and details, discussion. IH, BP were involved in sta- tistical evaluation, ... the predictive value for nodal metastasizing of lymphatic vessel invasion (L1) using the conventional and immunohistochemical method in squamous c...

Ngày tải lên: 09/08/2014, 04:21

... Central Page 1 of 4 (page number not for citation purposes) World Journal of Surgical Oncology Open Access Case report Pancreatic adenocarcinoma in a patient with Situs Inversus: a case report of ... are at increased risk of malignancy. Since that time there have been no new reported cases of pancreaticoduodenectomy in SI patients. We present a case of...

Ngày tải lên: 09/08/2014, 04:21

... Importantly, primary breast cultures retain progenitor/ stem cell populations [7]. Using primary cultures from human breast tumour and non -tumour tissue, we sought to define correlations between progenitor ... Arnold DK Hill 1 and Ann M Hopkins 1* Abstract Background: Many factors in fluence breast cancer progression, including the ability of progenitor cells to su...

Ngày tải lên: 10/08/2014, 10:21

... 7:16 http://www.head-face-med.com/content/7/1/16 Page 3 of 6 CASE REP O R T Open Access Autologous bone marrow stem cell intralesional transplantation repairing bisphosphonate related osteonecrosis of the jaw Luigi Cella 1 , Aldo Oppici 1 , ... offered the opportunity to our patient of injection of autologous bone marrow stem cells into the osteone...

Ngày tải lên: 11/08/2014, 20:21

... the pollen grains to undergo the 180° turning [22,23]. In the formation of the pollen wall, callose dissolution occurs concomitantly with the layering of the exine [54] and the formation of the ... and the development of inward facing intines may play a role in protecting pollen against desiccation. Conclusion The results obtained in this work support...

Ngày tải lên: 12/08/2014, 03:21