Báo cáo khoa học: "Malignant gastrointestinal stromal tumor presenting with hemoperitoneum in puerperium: report of a case with review of the literature" ppt

Báo cáo khoa học: Enhanced sensitivity to hydrogen peroxide-induced apoptosis in Evi1 transformed Rat1 fibroblasts due to repression of carbonic anhydrase III docx

Báo cáo khoa học: Enhanced sensitivity to hydrogen peroxide-induced apoptosis in Evi1 transformed Rat1 fibroblasts due to repression of carbonic anhydrase III docx

... TAMRA rat caIII probe: cttcaccacgccaccctgc gag 5¢ rat gapdh: gggcagcccagaacatca 3¢ rat gapdh: ccgttcagctctgggatgac 5¢ 6-FAM, 3¢ TAMRA rat gapdh probe: ccctgcatccactgg tgctgcc Preparation of total ... knockdown of caIII mRNA and protein and enhanced caspase 3 catalytic activity in Rat1 cells. Fig. S2. DsiRNA-mediated knockdown of caIII mRNA and protein and caspase 3 catalytic activity...

Ngày tải lên: 29/03/2014, 08:20

12 446 0
Báo cáo khoa học: "Growth, gas exchange and carbon isotope discrimination in young Prunus avium trees growing with or without individual lateral shelters" doc

Báo cáo khoa học: "Growth, gas exchange and carbon isotope discrimination in young Prunus avium trees growing with or without individual lateral shelters" doc

... Gas exchange parameters were calculated on a leaf area basis. Leaf area was determined in situ just prior to the gas exchange measure- ments by means of a portable area ... unit area (LMA, ra- tio of leaf mass to leaf area). Relative carbon isotope composition (δ p) of the leaves was higher in treatment C than in treatme...

Ngày tải lên: 08/08/2014, 23:22

10 369 0
Báo cáo khoa học: "Malignant mixed tumor in the salivary gland of a cat" potx

Báo cáo khoa học: "Malignant mixed tumor in the salivary gland of a cat" potx

... malignant mixed tumors of the salivary glands, carcinoma ex mixed tumors, carcinosarcomas, and metastatic mixed tumors with a benign appearance [3]. Nearly 99% of malignant mixed tumors are carcinoma ... Radiographic images of the head showing a large tissue-dense mass (A) with faint circular calcific opacity (B). Malignant mixed tumor in the salivary gland of a...

Ngày tải lên: 07/08/2014, 20:24

3 302 0
Báo cáo khoa học: "Medical emergency teams: deciphering clues to crises in hospitals"

Báo cáo khoa học: "Medical emergency teams: deciphering clues to crises in hospitals"

... time of day and the incidence of crisis recognition in hospitals. Their review of over 2000 events revealed an increase in events at certain times of the day, notably near nursing handoffs and ... for Healthcare Improvement and the Society for Critical Care Medicine have been promoting rapid response teams and METs. In North America and in Europe, there now appears to...

Ngày tải lên: 25/10/2012, 10:45

2 442 0
Tài liệu Báo cáo khoa học: Collagen I regulates matrix metalloproteinase-2 activation in osteosarcoma cells independent of S100A4 pdf

Tài liệu Báo cáo khoa học: Collagen I regulates matrix metalloproteinase-2 activation in osteosarcoma cells independent of S100A4 pdf

... MMPs are secreted as inactive proenzymes and latency is maintained by an interaction between a cystein residue in the prodomain and Zn 2+ in the active site of the catalytic domain. Two major ... 5275 protein in the two cell lines was determined as described in Materials and methods, and 81 lg of pro- tein was added to each well. The amount of S10 0A4 in the II-1...

Ngày tải lên: 18/02/2014, 11:20

12 572 0
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

... [9]. Selection of the DNA-binding site A 60 bp single-stranded DNA RDM10, with 10 random- ized oligonucleotides in the center, i.e. CTGTCAGTGAT GCATATGAACGAATN 10 AATCAACGACATTAGGATC CTTAGC was synthesized. ... competition assay were the same as used in the quantitative DNA-bind- ing assay described above. The radioisotope-labelled DNA probe was first mixed with the bin...

Ngày tải lên: 18/02/2014, 13:20

10 464 1
Tài liệu Báo cáo khoa học: Staphylococcal enterotoxin C1-induced pyrogenic cytokine production in human peripheral blood mononuclear cells is mediated by NADPH oxidase and nuclear factor-kappa B doc

Tài liệu Báo cáo khoa học: Staphylococcal enterotoxin C1-induced pyrogenic cytokine production in human peripheral blood mononuclear cells is mediated by NADPH oxidase and nuclear factor-kappa B doc

... lucigenin (Sigma Chemical Co.) in HBSS into the stainless cell of the system. The area under the curve was calculated to obtain total chemiluminescence. Statistical analysis The animals were maintained ... response to the superna- tant fluids of SEC1-stimulated PBMC in rabbits was in parallel with the levels of interleukin-1b and interleukin-6 in the supernatant...

Ngày tải lên: 19/02/2014, 00:20

13 465 0
Tài liệu Báo cáo khoa học: Various secretory phospholipase A2 enzymes are expressed in rheumatoid arthritis and augment prostaglandin production in cultured synovial cells docx

Tài liệu Báo cáo khoa học: Various secretory phospholipase A2 enzymes are expressed in rheumatoid arthritis and augment prostaglandin production in cultured synovial cells docx

... (C–E) Staining of sPLA 2 -V in three active RA tissues. In all cases, intense staining of the granulation tissue in the sublining interstitium was evident. Staining of the granulation tissue and ... Administration of PGE 2 into the hind paws of rats with adjuvant arthritis (a rat model of RA) exacerbates edema [49], and gene targeting of enzymes involved in t...

Ngày tải lên: 19/02/2014, 16:20

18 432 0
Tài liệu Báo cáo khoa học: "Wikipedia as Sense Inventory to Improve Diversity in Web Search Results" doc

Tài liệu Báo cáo khoa học: "Wikipedia as Sense Inventory to Improve Diversity in Web Search Results" doc

... want to consider approaches that involve a manual creation of train- ing material, because they can’t be used in prac- tice. Given a Web page p returned by the search engine for the query w, and ... listed in the Wikipedia dis- ambiguation page. We have also experimented with a variant of the approach that uses our estimation of sense fre- quencies, similarly to what...

Ngày tải lên: 20/02/2014, 04:20

10 526 1
Từ khóa:
w