... taggers can help in building automatic word-sense disambiguating algorithms, and POS taggers are also used in advanced ASR language models such as class- based n-grams (Jurafsky and Martin, ... Studies and Cultural Researches. Khanlari, Parviz (1351) Dasture Zabāne Fārsi, Tehran Bonyad Farhangy Iran. Khatibrahbar, Khalil (1367) Dasture Zabāne Farsi: Ketabe Harfe ezāfe va Rabt....
Ngày tải lên: 08/03/2014, 02:21
... Wares had previously made a survey of indigenous groups that speak Yuman languages in Lower California and around the Colorado River delta. His list of around 600 words collected in Paipai ... computer analysis of Wares's data was the phonological separation of velar and back velar stops and fricatives. Wares had noted phonetic k and ķ, x and ҳ in his transcription. He had...
Ngày tải lên: 16/03/2014, 19:20
Báo cáo khoa học: Kinetic mechanism for p38 MAP kinase a A partial rapid-equilibrium random-order ternary-complex mechanism for the phosphorylation of a protein substrate potx
... triphosphate; MKK3, MAP kinase kinase 3; MKK6, MAP kinase kinase 6; MKP3, MAP kinase phosphatase; NADH, nicotinamide adenine dinucleotide; p38 MAPKa, p38 mitogen-activated protein kinase alpha. FEBS Journal 272 ... was set at 20%. Data evaluation, integration, analysis, and determination of binding parame- ters were performed using origin 5.0 software (Microcal, Inc.). Final protein and ligan...
Ngày tải lên: 16/03/2014, 22:20
Báo cáo khoa học: "Distributional Representations for Handling Sparsity in Supervised Sequence-Labeling" pptx
... words that appear rarely in the labeled training data, but appear at least ten times in sections 2-22. Tables 2 and 3 show the accuracy of our smoothed models and the baseline model on tagging and ... consider a common scenario where rare terms make up a much larger fraction of the test data. 3.3 Domain Adaptation For our experiment on domain adaptation, we fo- cus on NP chunking an...
Ngày tải lên: 17/03/2014, 01:20
Báo cáo khoa học: "SOFTWARE TOOLS FOR THE ENVIRONMENT OF A COMPUTER AIDED TRANSLATION SYSTEM" pptx
... as a documentation tool for linguistic applications ; - as a debugging tool for linguistic applications ; - as a tool for converting the lexical base into a new form (for instance, loading ... factors : the dispersal of infor- mation and the obscurity of the coding. In ARIANE-78, the lexical data base may reside on much more 50 files, for a given pair of language....
Ngày tải lên: 17/03/2014, 19:21
Báo cáo khoa học: "Statistical Modeling for Unit Selection in Speech Synthesis" pptx
... Weighted Finite Automata. In Finite-State Language Pro- cessing, pages 431–453. MIT Press. Arto Salomaa and Matti Soittola. 1978. Automata- Theoretic Aspects of Formal Power Series. Springer-Verlag: ... Brian Roark. 2004. A General Weighted Gram- mar Library. In Proceedings of the Ninth International Conference on Automata (CIAA 2004), Kingston, Ontario, Canada, July. http://www.researc...
Ngày tải lên: 23/03/2014, 19:20
Báo cáo khoa học: "Feasibility Study for Ellipsis Resolution in Dialogues by Machine-Learning Technique" docx
... ':before ~1/~3 '3 which are still important regardless of the training size. This indicates the advantages of a machine- learning approach, because difficulties always arise in ... in Dialogues by Machine-Learning Technique YAMAMOTO Kazuhide and SUMITA Eiichiro ATR Interpreting Telecommunications Research Laboratories E-mail: yamamot o©it I. atr. co. jp Abstract A...
Ngày tải lên: 23/03/2014, 19:20
Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt
... intro- duced using primers P4 (5¢-atgtagccattgtatttgaaaatgagcaact) and P5 ( 5¢- agttgctcattttcaaatacaatggctacat), and P6 (5¢- gaacagc cgtatttggccgcttattttgtatc) and P7 (5¢- gatacaaaataagcggccaaa tacggctgttc), ... between A and peptidyl carrier protein domains of a multi- domain nonribosomal peptide synthetase. Abbreviations A domain, adenylation domain; ANL, aryl and acyl CoA synthetase...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo khoa học: Novel strategy for protein production using a peptide tag derived from Bacillus thuringiensis Cry4Aa pptx
... Okayama University, Japan 2 Department of Bioscience, Japan Lamb Co. Ltd, Development Division, Okayama, Japan Introduction Cry toxin, a specific insecticidal protein against insect larvae, has ... syphilis antigen Correspondence H. Sakai, Graduate School of Natural Science and Technology, Okayama University, 3-1-1 Tsushima-Naka, Okayama 700-8530, Japan Fax ⁄ Tel: +81 86 251 8203 E-mail: sak...
Ngày tải lên: 29/03/2014, 09:20
Báo cáo khoa học: "Pattern Learning for Relation Extraction with a Hierarchical Topic Model" pptx
... general patterns that appear for all relations. φ D captures patterns that are spe- cific about a certain entity pair, but which are not generalizable across all pairs with the same relation. Finally ... Titov and A. Klementiev. 2011. A bayesian model for unsupervised semantic parsing. In The 49th Annual Meeting of the Association for Computational Linguis- tics. C. Wang, J. Fan,...
Ngày tải lên: 30/03/2014, 17:20