Báo cáo khoa học: "Management options for vulvar carcinoma in a low resource setting" pdf
Báo cáo khoa học: "An Account for Compound Prepositions in Farsi" docx
... taggers can help in building
automatic word-sense disambiguating
algorithms, and POS taggers are also used in
advanced ASR language models such as class-
based n-grams (Jurafsky and Martin, ... Studies and
Cultural Researches.
Khanlari, Parviz (1351) Dasture Zabāne Fārsi,
Tehran Bonyad Farhangy Iran.
Khatibrahbar, Khalil (1367) Dasture Zabāne
Farsi: Ketabe Harfe ezāfe va Rabt....
Báo cáo khoa học: "Computer Backup for Field Work in Phonology" pdf
...
Wares had previously made a survey of indigenous
groups that speak Yuman languages in Lower California
and around the Colorado River delta. His list of around
600 words collected in Paipai ... computer analysis
of Wares's data was the phonological separation of velar
and back velar stops and fricatives. Wares had noted
phonetic k and ķ, x and ҳ in his transcription. He had...
Báo cáo khoa học: Kinetic mechanism for p38 MAP kinase a A partial rapid-equilibrium random-order ternary-complex mechanism for the phosphorylation of a protein substrate potx
... triphosphate;
MKK3, MAP kinase kinase 3; MKK6, MAP kinase kinase 6; MKP3, MAP kinase phosphatase; NADH, nicotinamide adenine dinucleotide;
p38 MAPKa, p38 mitogen-activated protein kinase alpha.
FEBS Journal 272 ... was set at 20%. Data evaluation,
integration, analysis, and determination of binding parame-
ters were performed using origin 5.0 software (Microcal,
Inc.). Final protein and ligan...
Báo cáo khoa học: "Distributional Representations for Handling Sparsity in Supervised Sequence-Labeling" pptx
... words
that appear rarely in the labeled training data, but
appear at least ten times in sections 2-22. Tables 2
and 3 show the accuracy of our smoothed models
and the baseline model on tagging and ... consider
a common scenario where rare terms make up a
much larger fraction of the test data.
3.3 Domain Adaptation
For our experiment on domain adaptation, we fo-
cus on NP chunking an...
Báo cáo khoa học: "SOFTWARE TOOLS FOR THE ENVIRONMENT OF A COMPUTER AIDED TRANSLATION SYSTEM" pptx
... as a documentation tool for linguistic
applications ;
-
as a debugging tool for linguistic applications ;
-
as a tool for converting the lexical base into
a new form (for instance, loading ... factors : the dispersal of infor-
mation and the obscurity of the coding. In
ARIANE-78, the lexical data base may reside on
much more 50 files, for a given pair of language....
Báo cáo khoa học: "Statistical Modeling for Unit Selection in Speech Synthesis" pptx
... Weighted
Finite Automata. In Finite-State Language Pro-
cessing, pages 431–453. MIT Press.
Arto Salomaa and Matti Soittola. 1978. Automata-
Theoretic Aspects of Formal Power Series.
Springer-Verlag: ... Brian
Roark. 2004. A General Weighted Gram-
mar Library. In Proceedings of the Ninth
International Conference on Automata (CIAA
2004), Kingston, Ontario, Canada, July.
http://www.researc...
Báo cáo khoa học: "Feasibility Study for Ellipsis Resolution in Dialogues by Machine-Learning Technique" docx
... ':before
~1/~3 '3
which are
still important regardless of the training size.
This indicates the advantages of a machine-
learning approach, because difficulties always
arise in ... in Dialogues
by Machine-Learning Technique
YAMAMOTO Kazuhide and SUMITA Eiichiro
ATR Interpreting Telecommunications Research Laboratories
E-mail: yamamot o©it I. atr. co. jp
Abstract
A...
Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt
... intro-
duced using primers P4 (5¢-atgtagccattgtatttgaaaatgagcaact)
and P5 ( 5¢- agttgctcattttcaaatacaatggctacat), and P6 (5¢- gaacagc
cgtatttggccgcttattttgtatc) and P7 (5¢- gatacaaaataagcggccaaa
tacggctgttc), ... between A and peptidyl carrier protein domains of a multi-
domain nonribosomal peptide synthetase.
Abbreviations
A domain, adenylation domain; ANL, aryl and acyl CoA synthetase...
Báo cáo khoa học: Novel strategy for protein production using a peptide tag derived from Bacillus thuringiensis Cry4Aa pptx
... Okayama University, Japan
2 Department of Bioscience, Japan Lamb Co. Ltd, Development Division, Okayama, Japan
Introduction
Cry toxin, a specific insecticidal protein against insect
larvae, has ... syphilis
antigen
Correspondence
H. Sakai, Graduate School of Natural
Science and Technology, Okayama
University, 3-1-1 Tsushima-Naka, Okayama
700-8530, Japan
Fax ⁄ Tel: +81 86 251 8203
E-mail: sak...
Báo cáo khoa học: "Pattern Learning for Relation Extraction with a Hierarchical Topic Model" pptx
... general patterns that appear
for all relations. φ
D
captures patterns that are spe-
cific about a certain entity pair, but which are not
generalizable across all pairs with the same relation.
Finally ... Titov and A. Klementiev. 2011. A bayesian model for
unsupervised semantic parsing. In The 49th Annual
Meeting of the Association for Computational Linguis-
tics.
C. Wang, J. Fan,...
Từ khóa: