báo cáo khoa học: "Colonic perforation resulting from ingested chicken bone revealing previously undiagnosed colonic adenocarcinoma: report of a case and review of literature" ppt

... CASE REP O R T Open Access Colonic perforation resulting from ingested chicken bone revealing previously undiagnosed colonic adenocarcinoma: report of a case and review of literature Douglas ... douglas.mcgregor@va.gov 1 Department of Pathology and Laboratory Medicine, University of Kansas Medical Center, Kansas City, Kansas, USA Full list of au...

Ngày tải lên: 09/08/2014, 01:24

... of a protein Rama-Haritha Pusarla*, Vinesh Vinayachandran* and Purnima Bhargava Centre for Cellular & Molecular Biology, Hyderabad, India Multifold compaction of DNA due to the presence of nucleosomes ... chromatin was assembled at 50 m M salt for lanes 1–4, and at 70 mM salt for lanes 5–8. (B) IEL analysis for the chromatin assem- bled at 90 and 110 m M salt concentrations....

Ngày tải lên: 16/03/2014, 10:20

... dinitrogen by Bacteria and Archaea. Adv Microb Physiol 52, 107–227. 24 Uthandi S, Saad B, Humbard MA & Maupin-Furlow JA (2010) LccA, an archaeal laccase secreted as a highly stable glycoprotein ... both laccases and metallo-oxidases, are well characterized in eukaryotes and bacteria, only one archaeal laccase has been described so far [24]. Although the recombinant purified McoP is...

Ngày tải lên: 18/02/2014, 04:20

... instrument, process and normalize it to agreed standards and finally transfer these data to publicly available data- bases to make them accessible. To facilitate the dissemination of data, a number of initiatives ... search capability for kinetic data and corresponding metadata stored in SABIO-RK. The task of automatically finding para- meters and associated data is aided by spe...

Ngày tải lên: 18/02/2014, 04:20

... F, Pagano MA, Antonelli M, Allende CC, Pinna LA & Allende JE (2003) A noncanonical sequence phosphorylated by casein kinase 1 in beta-catenin may play a role in casein kinase 1 targeting of ... effec- tive rate constants of phosphorylation and dephosphor- ylation, a ran and b ran , defined as follows: a ran ¼ðN À n þ 1 a and b ran ¼ nb; ð6Þ where a and b are as given...

Ngày tải lên: 18/02/2014, 08:20

... (GAPDH) mRNA quantification in colon carcinoma and rectal carcinoma as compared to normal colonic tissue. Colon carcinoma cells, rectal carcinoma cells and their normal healthy tissue counterparts ... in human cancers. To begin functional studies of s-DAPK-1, the s-DAPK-1 cDNA was cloned into a Flag–Myc vector (Fig. 2A) , which contains an N-terminal Flag tag and a C-terminal Myc...

Ngày tải lên: 18/02/2014, 17:20

... Roman J, Gimenez A, Lluis JM, Gasso M, Rubio M, Caballeria J, Pares A, Rodes J & Fernandez-Checa JC (2000) Enhanced DNA binding and activation of tran- scription factors NF-kappa B and AP-1 ... disulfiram. Alcohol Alcohol 28, 461–468. 30 Isse T, Oyama T, Kitagawa K, Matsuno K, Matsumoto A, Yoshida A, Nakayama K, Nakayama K & Kawa- moto T (2002) Diminished alcohol preference i...

Ngày tải lên: 19/02/2014, 06:20

... ln (a o – a e )/ (a t – a e ) ¼ k t ,wherea o , a t ,anda e are the observed angular rotations at time zero, t and equilibrium, respectively, and k is the calculated rate constant [10]. A linear increase ... bifunctional enzyme with aldose 1-epimerase activity Siddhartha Majumdar 1 , Jhuma Ghatak 2 , Sucheta Mukherji 2 , Hiranmoy Bhattacharjee 3 and Amar Bhaduri* 1 Division o...

Ngày tải lên: 19/02/2014, 12:20

... 88, 12–19. 19 Ohtani N, Yanagawa H, Tomita M & Itaya M (2004) Identification of the first archaeal type 1 RNase H gene from Halobacterium sp. NRC-1: archaeal RNase HI can cleave an RNA-DNA junction. ... chromosomal DNA during mammalian Okazaki fragment processing. J Biol Chem 272, 22591–22599. 9 Haruki M, Tsunaka Y, Morikawa M & Kanaya S (2002) Cleavage of a DNA-RNA-DNA ⁄ DNA ch...

Ngày tải lên: 19/02/2014, 18:20

... CTACTCACACTTGGCTTTAC TpdesM GATTCATCCGTATCATAATAGTAAG TGGAACCTATGCCACCAC TpdesN GTGAGAGCACTAACCAAGCTT CAATCAGTAGGCTTCGTCG TpdesO GATGAAGGCTGTTGGAAAG CATCATCCTCAATGCAACGG Yeast expression TpdesA GCGGGTACCATGGCTAGAGCTGTTTGGGCATTG ... GCGGGTACCATGGCTAGAGCTGTTTGGGCATTG GCGGAGCTCTCACGTGTACATGAAAGC TpdesB GCGGGTACCATGGCTCCACCCTCCATCAAAGAC GCGGAGCTCCTATCCCTGAGCACACAT TpdesI GCGGGATCCACCATGGCTGGAAAAG...

Ngày tải lên: 20/02/2014, 01:20