Báo cáo y học: "ECT associated musical hallucinations in an elderly patient: a case report" pps
... hallu- cinations [2,3]. Musical hallucinations are pseudo hallucinations that originate in memory representations and they may undergo a transition to true hallucination. In musical hal- lucination ... Central Page 1 of 3 (page number not for citation purposes) Annals of General Psychiatry Open Access Case report ECT associated musical hallucinations in an elderly...
Ngày tải lên: 08/08/2014, 21:20
... ellis.anne@gmail.com; Susan Waserman* - waserman@mcmaster.ca * Corresponding author Abstract Background: Markedly elevated IgE as a manifestation of a lymphoproliferative disorder has been only rarely ... myeloma, and B-cell lymphomas. In this case, the patient had no history of atopy, or parasitic infection and she had a nor- mal protein electrophoresis and bone marrow evaluation....
Ngày tải lên: 08/08/2014, 21:20
... 2001;413(6853):316-22. 4. Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu R, Imaki H, Ishida N, Okumura F, Nakayama K, Nakayama KI. Phosphorylation-dependent degradation of c-Myc is mediated by the F-box ... Tsunematsu R, Nakayama K, Oike Y, Nishiyama M, Ishida N, Hatakeyama S, Bessho Y, Kageyama R, Suda T, Nakayama KI. Mouse Fbw7/Sel-10/Cdc4 is required for notch degradation...
Ngày tải lên: 31/10/2012, 16:49
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... 5¢-CCGTT TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢. C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢. ... H24 4A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢. D21 6A: 5¢-G CGAGCTTATATCTTTTGCAATGAAGATAAATCAT TTCCAGTTGAG-3¢ All of the primers were 5¢-phosphorylate...
Ngày tải lên: 24/03/2014, 04:21
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot
... disease in most European countries, Australia, New Zealand, and North America. Conversely, this disease is rare in Scandinavia, Asia, and Africa. In Japan, it is extremely rare, with a prevalence ... syndromes. Here we present an unusual case of delayed union of a femur fracture secondary to Paget's disease in an Asian patient, which was treated success- fully by func...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo y học: "Alcohol use and abuse in training conscripts of the Hellenic navy" pps
... military corps is random, the conscript come urban, semi-urban and rural areas and they are of all educational levels and socioeco- Table 2: Frequency of problematic drinkers by means of adult ... nationwide general population survey. Acta Psychi- atrica Scandinavica 1994, 89:159-166. 14. World Health Organization: Alcohol consumption and harm. Hospital discharges, injury and poisoning per 10...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Increased plasma homocysteine levels in patients with multiple sclerosis and depression" ppsx
... Z, Jiang X, Gaubatz J, Yang F, Durante W, Chan L, Schafer AI, Pownall HJ, Yang X, Wang H: Hyperhomo- cysteinemia decreases circulating high-density lipoprotein by inhibiting apolipoprotein A- I ... B12 deficiency [7,18,19]. Our results, in agreement with Vrethem et al. [8] and Ramsaransing et al. [9], indicate that Hcy increases may occur in MS in the absence of vitamin B12 and folate...
Ngày tải lên: 08/08/2014, 23:21
báo cáo hóa học:" Multiple synchronous primary malignancies induced by benzene exposure: a case report" docx
... toxicity of benzene and its metabolism and molecular pathology in human risk assessment. Br J Ind Med 1991, 48:437-444. 3. Baak YM, Ahn BY, Chang HS, Kim JH, Kim KA, Lim Y: Aplastic ane- mia in a ... CR: 32P analysis of DNA adducts in tissues of benzene-treated rats. Environ Health Perspect 1989, 82:253-257. 14. Nakao A, Sakagami K, Nakata Y, Komazawa K, Amimoto T, Nakashima K, Iso...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " Melioidosis presenting with mediastinal lymphadenopathy masquerading as malignancy: a case report" pot
... Chiranjay Mukhopadhyay 2 , Vandana Kalwaje Eshwara 2 , Barkur Ananthakrishna Shastry 1 , Kundapura Ramamoorthy 1 , Sushma Krishna 3 , Vishwanath Sathyanarayanan 1 1 Department of Internal ... (chiranjay@yahoo.co .in) Vandana KALWAJE Eshwara (vandanake@gmail.com) Barkur ANANTHAKRISHNA Shastry (shastryba@yahoo.co .in) Kundapura Ramamoorthi (rmoorthy414@gmail.com) Sushma Krishna (chummu....
Ngày tải lên: 21/06/2014, 19:20
Báo cáo y học: "Grb2-associated binder 1 polymorphism was associated with the risk of Helicobactor pylori infection and gastric atrophy"
... AAC TTT ATT CTG ACT GTT CCC, R1: 5’ ACA CAA TTT AGT AAT AGC CAA AGT CAA C, F2: 5’ GTT GTT GTG AAG TAG AAA CTG ATT TCT AA, and R2: 5’ CTG GGG AGT GGG CCA. Genomic DNA was applied in a volume ... C, et al. A model for gastric cancer epidemiology. Lancet 1975; 2: 58-9. 21. Asaka M, Sugiyama T, Nobuta A, et al. Atrophic gastritis and intestinal metaplasia in Japan: results of a...
Ngày tải lên: 31/10/2012, 15:37