Báo cáo khoa học: "Assessing vegetation changes in the dry deciduous Ainurmarigudi Reserve Forest, South India" pot

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the specifici...

Ngày tải lên: 14/02/2014, 14:20

... for Metabolic gene switching in murine female heart M. F. Essop et al. 5282 FEBS Journal 274 (2007) 52785284 ê 2007 The Authors Journal compilation ª 2007 FEBS Metabolic gene switching in the murine ... Cooksey RC, McClain DA, Litwin SE et al. (2002) Insulin signaling coordinately M. F. Essop et al. Metabolic gene switching in murine female heart FEB...

Ngày tải lên: 18/02/2014, 16:20

... integrin-dependent cell volume sensing and signaling integrates into the overall context of insulin signaling. Similarly, sensing of glutamine-induced hepatocyte swelling by integrins feeds into ... 2007 The Authors Journal compilation ª 2007 FEBS MINIREVIEW Osmosensing and signaling in the regulation of mammalian cell function Freimut Schliess, Roland Rein...

Ngày tải lên: 18/02/2014, 16:20

... Mu ă ller V (2007) An intermediate step in the evolution of ATPases – the F 1 F 0 -ATPase from Aceto- bacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis. FEBS ... Journal 275 (2008) 19992007 ê 2008 The Authors Journal compilation ª 2008 FEBS An intermediate step in the evolution of ATPases – a hybrid...

Ngày tải lên: 18/02/2014, 17:20

... Follistatin, Chordin and Noggin [12]. These proteins are antagonists of BMP and other members of the TGF-b family, binding to and inhibit- ing these signaling molecules from binding to their receptors ... BMPs in the early development of zebrash FEBS Journal 274 (2007) 29602967 ê 2007 The Author Journal compilation ê 2007 FEBS 2963 MINIREVIEW Bone morphogenetic prote...

Ngày tải lên: 19/02/2014, 00:20

... integral membrane proteins from the mitochondrial outer membrane, and of the 11 most abundant integral proteins, 10 had a-helical transmem- brane segments. Of these 10 proteins, most had a single ... trans- membrane segments that are assembled into the mito- chondrial outer membrane. Results and Discussion Integral membrane proteins in the mitochondri...

Ngày tải lên: 19/02/2014, 07:20

... following/ the targeted word and the one preceding/ the targeted word and the one following/ the targeted word and the two preceding/ the targeted word and the two fol- lowing), and the first ... * there is telephone and the books on the desk. Ebk: The word in the beginning of the part which should be replaced and which error category is k. Eek : Th...

Ngày tải lên: 20/02/2014, 16:20

... examine the pragmatic knowledge an utterance -planning system must have in order to produce certain kinds of definite and indefinite noun phrases. An utterance .planning system, like other planning ... knowledge. Since there are two dimensions relevant to ,:haracteriz- ing concept activation actions, it is possible to define four 199 Some Pragmatic Issues in...

Ngày tải lên: 21/02/2014, 20:20

... local conformational changes induced by PLP binding to the active site. PLP binding to the apo-Ecb induced the following major conformational changes. (a) PLP bound to the N terminus of Helix 9 induces ... result indicates that the hydrophobic interaction at the subunit interface of the dimer increases with PLP binding. Upon binding of PLP to the active site...

Ngày tải lên: 15/03/2014, 11:20

... 0.05. Hemoglobin expression in Drosophila E. Gleixner et al. 5112 FEBS Journal 275 (2008) 5108–5116 ª 2008 The Authors Journal compilation ª 2008 FEBS Oxygen-induced changes in hemoglobin expression ... during certain developmental stages. The observation that Drosophila dmeglob1 pro- tein exhibits ligand-binding properties and expression patterns that resemble those of...

Ngày tải lên: 30/03/2014, 02:20

... those belonging to 10-20 cm and Original article Assessing vegetation changes in the dry deciduous Ainurmarigudi Reserve Forest, South India A Gaulier JP Pascal JP Puyravaud 1 ... Saplings were not saved either, but the openings created in the stand would have favoured the growth of survivors, which explains the rise in the num- b...

Ngày tải lên: 08/08/2014, 19:21

... of the spruce needles did not increase during the day but remained constant at its minimum level (Fig. 1A). Enclosing branches in the bag within the period of increasing ... It may therefore be concluded that the diurnal variations in the glutathione content of spruce needles are due to changes in the export of glutathione out o...

Ngày tải lên: 09/08/2014, 03:24

... Pgm v decreased and Pgm s decreased or remained stable). Allozyme frequency changes in two inverse sequences of environments in Drosophila melanogaster H. MERầOT Laborntoire de ... pattern of changes in the allelic frequencies of a diallelic locus submitted to 2 reverse sequences of environments. The simulations showed that the patter...

Ngày tải lên: 09/08/2014, 22:23

... promote abstinence. In addition, patients may welcome tobacco use prevention and cessation (TUPA C) counselling. Stu - dies indicate that about 80% of tobacco users in Finland are worried about ... questionnaire was piloted among a sample of dentists and dental hygienists (n = 30) working in municipal dental clinics in Helsinki, Finland. Piloting indicated that th...

Ngày tải lên: 10/08/2014, 10:23

... distribution of transcription factor binding sites along the genes and tran- scription factor binding modules were revealed. Compar- ison of the predicted MAR with the TBP binding sites in the Bmy1 gene ... degradation of TBPs could be one of the mechanisms of the promoter inactivation. Interest- ingly in the dormant Bmy 1gene the 300 bp region upstream the...

Ngày tải lên: 12/08/2014, 03:20