Báo cáo khoa học: " spread of Rhizophagus grandis Gyll (Coleoptera: Rhizophagidae) 6 years after release in the Forêt domaniale du Mézenc (France)" ppt

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG ScCoq7-b CCCCCGGGGCCACTTTCTGGTG Spcoq7 -a GTACAAGCTTGTAAATTTTCGATGG Spcoq7-b CATAGAATTCTTGGTAATC Spcoq7-c AAAGTCGACATGTTGTCACGTAGACAG Spcoq7-w...

Ngày tải lên: 18/02/2014, 14:20

... of the sole Glyco_18 domain, the C-terminal tail of C. gigas CLPs may not noticeably contribute to the structure and the function of these proteins. Interestingly, Cg-Clp1 and Cg-Clp2 C-terminal ... Oyster chitinase-like proteins FEBS Journal 274 (2007) 36463654 ê 2007 The Authors Journal compilation ª 2007 FEBS 3651 Characterization of chitinase-like protei...

Ngày tải lên: 19/02/2014, 00:20

... H + - ATPase inhibitor bafilomycin and the cathepsin D inhibitor pepstatin A partially inhibited, both in vivo and in vitro, the cAMP response to cholera toxin. This cathepsin D- dependent action of cholera ... action of cholera toxin in rat liver parenchyma. Following administration of a saturating dose of cholera toxin to rats, rapid endocytosis of bot...

Ngày tải lên: 19/02/2014, 02:20

... recy- cling. Initiation is the rate-limiting step [1] . This phase is mediated by initiation factor 1 (IF1), initiation fac- tor 2, and initiation factor 3. IF1 is the smallest of the initiation factors ... chloramphenicol; IF1, initiation factor 1; Kan, kanamycin; Tet, tetracycline; TIR, translation initiation region. FEBS Journal 278 (2 011 ) 17 4 517 56...

Ngày tải lên: 06/03/2014, 00:21

... (h) A 600 0 2 4 6 8 10 12 14 024487296 Wild-type Dcoq2 + 50 à M CoQ 2 Dcoq2 + 50 àM decylQ Dcoq2 0 2 4 6 8 10 A 600 DCoQ CoQ 2 DecylQ A1 -Q 2 A4 -Q 2 A5 -Q 2 A6 -Q 2 A3 -Q 2 A2 -Q 2 AB O O MeO MeO A1 -Q 2 O O MeO MeO A6 -Q 2 O O MeO MeO A5 -Q 2 O O MeO MeO A4 -Q 2 O O MeO MeO A3 -Q 2 O O MeO MeO A2 -Q 2 O O MeO MeO DecylQ O O MeO MeO CoQ 2 O O MeO MeO CoQ 6 C Fig. ... ubiquinones....

Ngày tải lên: 06/03/2014, 11:20

... Membrane -reconstituted human CYP1A1 (Eur. J. Biochem. 269) 1805 PRIORITY PAPER Epoxidation of benzo[ a ]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity ... correlation between the activation of the CYP1A1- catalyzed epoxidation reaction of 7,8-diols a nd the enhanced nonbil...

Ngày tải lên: 08/03/2014, 10:20

... charac- teristics resemble those of the natural aging process in humans and other animals. As the inner ear tissue is unacquirable during life in humans, and the genetic and environmental background ... capacity to repair oxidative DNA damage in various brain regions during aging was altered in an age-dependent manner, and increased mtDNA oxidative damage mig...

Ngày tải lên: 14/03/2014, 23:20

... house Degree of taking instructions from owner Đ Foot disinfectant at the entrance of the building Frequency of renewing the disinfectant ∥ Wearing separated boots at each building On the farm Off ... experimentally in- oculated with avian influenza viruses of low and high pathogenicity. Avian Dis 1997, 41, 125-136. 12. Naeem K, Naurin M, Rashid S, Bano S....

Ngày tải lên: 07/08/2014, 20:23

... 10% of the timber was ranked as quality class B (good quality) ,

Ngày tải lên: 08/08/2014, 18:21

... jth edger sawline and kth docking sawline; Original article Effect of edging and docking methods on volume and grade recoveries in the simulated production of flitches CL ... flitch. In the following extract, the term ’trimming’ is equivalent to docking ; and ’cutting-line combinations’ refers to the com- binations of edging...

Ngày tải lên: 08/08/2014, 19:21

... df) between Original article Establishment and spread of Rhizophagus grandis Gyll (Coleoptera: Rhizophagidae) 6 years after release in the Forêt domaniale du Mézenc (France) ... result from the fact that, in the Forêt du Mézenc, R grandis is still invading the stand, and that its spread in space involves most of the...

Ngày tải lên: 08/08/2014, 19:21

... in their perception of their malocclusion. Also, there is no evidence of how the severity of those traits is perceived by people. These shortcomings of the IOTN indicate the need to study the ... anyone to seek treatment regardless of the severity of his or her malocclusion. Therefore, it is recom- mended to use the DHC of the IOTN as a screening tool to re...

Ngày tải lên: 11/08/2014, 23:22

... Central Page 1 of 9 (page number not for citation purposes) Head & Face Medicine Open Access Research Efficacy of low level laser therapy on neurosensory recovery after injury to the inferior alveolar ... I, Peterson LJ: Clinical efficacy of low level laser treatment of oro-facial neurosensory deficits. J Oral Maxillofac Surg 1993:182. 26. Wal...

Ngày tải lên: 11/08/2014, 23:22

... BbrizUBCE and BbrizTUB were again the more stable and the least stable genes respectively, while there was a slight difference in the order of stability of the other genes. The second and third best reference ... both apomictic and sexual reproduc- tion within Brachiaria makes it an interesting system for understanding the molecular pathways involved in...

Ngày tải lên: 12/08/2014, 03:20

... match. Detomidine sedation The impaired pulmonary gas exchange and arterial oxygenation during detomidine sedation in the present study reconfirm previous observations during sedation of horses with a 2 -agonists ... investigation was to determine the physiological effects, especially on the pulmonary gas exchange, of sedation with detomidine alo...

Ngày tải lên: 12/08/2014, 18:22