Báo cáo khoa học: "An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different branching intensities" ppt

... Growth and flowering in roses. Acta Hor- tic 218, 121-130 Original article An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different ... control (Barnola et al, 1986; Alatou et al, 1989; Barnola et al, 1990; Par- mentier et al, 1991; Barnola et al, 1993). As the formation of lateral...

Ngày tải lên: 08/08/2014, 19:21

... German original text and a raw (unedlted, but automatically reformatted) METAL translation of that into English. History and Status Machine translation research at the University of Texas ... structure equating the source language canonical form with an appropriate target language canonical form. Certain significant information (i. e., lexical category, subject area, and pr...

Ngày tải lên: 01/04/2014, 00:20

... xolal(xll(ala)),xll(x21(ala)),x21(ala),ala, ala, ala, ala, ala, a xo Figure 5: Example for comparison of methods one for edge for each subset of the indices deriv- ing from the antecedents ... certain similarities between categorial gram- mars and the D-Tree grammar (DTG) formal- ism of Rambow et al. (199 5a) . On this basis, we have explored adapting the DTG parsing ap...

Ngày tải lên: 20/02/2014, 19:20

... and the cytoplasm. Whereas cytoplasmic TRADD mediates apoptosis through FADD and caspase-8 activation, nuclear TRADD acts through a mitochondrial apoptosis pathway [28]. Our study provides, for ... cytoplasm. This induc- ible nuclear–cytoplasmic translocation of FADD is independent of CD95 internalization, formation of the death-inducing signaling complex, and caspase-8 activation....

Ngày tải lên: 07/03/2014, 02:20

... wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢;NF1mut,5¢-TTTT GGATTGAATAAAATATGATA-3¢;Site-2wt,5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢;Site-2mut,5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢;Site-3wt, 5¢-GGGTTCTTTTGGCATCCCTGTAGC-3¢;Site-3mut, 5¢-GGGTTCTTTTTAAATCCCTGTAGC-3¢. Chromatin ... 259327110, E-mail: Katarina.Luciakova@savba.sk Abbreviations: ANT, adenine nucleotide translocase; N...

Ngày tải lên: 07/03/2014, 15:20

... contrast with GABARAP, no quantitative data are available for these interactions. Most impor- tantly, the interaction of CRT with GABARAP occurs with natively folded GABARAP. This is clearly ... association and dissociation rates were fitted as global parameters, whereas the maxi- mum response R max was fitted as a separate parameter for each binding sensorgram. The dissociati...

Ngày tải lên: 16/03/2014, 05:20

... Constant Class “The class that has a stable frequency with time-series variation” (3) Decreasing Class “The class that has a decreasing frequency with time-series variation”. We call these classes ... frequencies relatively stable with time-series variation. The names of baseball players “Hank-Aaron” and “Nap Lajoie” are included in a decreasing class because their freque...

Ngày tải lên: 20/02/2014, 16:20

... Microcal (Northampton, MA, USA). The ther- mal denaturation of Cel7 4A was completely irreversible, and no transition was seen in a repeat scan; therefore, an apparent T m was approximated as the ... was performed with the LCQ Classic and Advantage (Thermo Electron Corporation, Waltham, MA, USA) for the determination of the molecu- lar mass and for peptide mapping, respectively...

Ngày tải lên: 19/02/2014, 05:20

... 2109 Australia NSW 2109 Australia madras@ics.mq.edu.au Abstract In evaluating the output of language tech- nology applications—MT, natural language generation, summarisation—automatic eval- uation ... is quite different for each. Connexor is a commercially available dependency parser that returns head–dependant relations as well as stemming information, part of speech, and so on...

Ngày tải lên: 20/02/2014, 12:20

... 0.83 With Case Information (Case) Lower Case (NoCase) Lower Case & Stemmed (Stem) With Case Information (Case) Lower Case (NoCase) Lower Case & Stemmed (Stem) Table 1. Pearson’s ρ and Spearman’s ... the evaluations of ROUGE-L, ROUGE-S, and compare their per- formance with other automatic evaluation meas- ures. 5 Evaluations One of the goals of developing automatic eva...

Ngày tải lên: 20/02/2014, 16:20