Báo cáo khoa học: "Measurement and transmission within modelling a of radiation stand of maritime pine" pot

... understorey, λ is the accumulated LAI of the canopy and Thermal infrared (longwave radiation) As for the diffuse radiation, the longwave radiation coming from a point of ... and Varlet-Grancher, 1977) and with this approximation, the radiation balance at level λ can be written as: where R+ (λ) is the downwar...

Ngày tải lên: 08/08/2014, 19:21

... HIGH and KMSKS, and by having a catalytic domain with a classical Rossmann- fold topology [13–16]. Class 2 aaRSs have their active- site residues located in an antiparallel b-sheet [10]. Each class ... amino acids is catalyzed b y their cognate aaRSs, one for each amino acid [5]. However, not all bacterial pathogens possess all 20 aaRSs; only the eukaryotic spe- cies and a few eub...

Ngày tải lên: 06/03/2014, 22:21

... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites of ... S, Khachatr- yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotoga maritima stationary phase survival protein SurE: a novel acid...

Ngày tải lên: 18/02/2014, 14:20

... tract, gills, heart and labial palp) including female gonads (oocytes), and from various stages of embryonic and larval devel- opment (blastula, gastrula, trochophore larvae, D lar- vae, 7 and ... algorithm for each node. Isolation and characterization of Cg-BMPR1 and Cg-TGFbsfR2 TGFb genes A C. gigas genomic library was constructed in kDASH II (Stratagene, La Jolla, CA, USA...

Ngày tải lên: 07/03/2014, 21:20

... is that we are using human clause and sentence labels to create a candidate set for the clause boun- dary features evaluated by the Stanford Parser and Tregex, as explained in the following ... operationally. 725 test-3-SB (human transcript based, and using au- tomated boundaries) around 0.2, and for sets NN- test-4-ASR-CB and NN-test-5-ASR-SB (ASR hy- potheses, and usin...

Ngày tải lên: 07/03/2014, 22:20

... the ERK1 ⁄ 2 pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of tran- scription (JAK-STAT) pathway, to promote prolifera- tion, survival and transformation [56,57]. ... 854–864. 62 Kuribara R, Honda H, Matsui H, Shinjyo T, Inukai T, Sugita K, Nakazawa S, Hirai H, Ozawa K & Inaba T (2009) Roles of Bim in apoptosis of normal and Bcr-Abl-expressi...

Ngày tải lên: 16/03/2014, 00:20

... gives an explanation for the difference between aspectual information understood as a view on a situation and temporal features of a situation. The former can be gained after applying a certain ... the initial and finishing points of a situ- ation are indicated by I and F respectively. The duration of the situation can be drawn in two differ- ent ways: as an unstr...

Ngày tải lên: 17/03/2014, 09:20

... (H6 of Rha and Fuc) at d 1.21–1.40, one C-CH 2 -C group at d 1.76 and 1.52 (H4ax and H4eq of ara4dHex, respectively) and one O-acetyl group at d 2.19. These data were in agreement with a tetrasaccharide ... sugar and methylation analyses. Serological methods Rabbit antisera against Citrobacter strains PCM 1531 and PCM 1487 were prepared as described previously [21]. Passive...

Ngày tải lên: 23/03/2014, 17:22

... proposes the application of finite-state approximation techniques on a unification-based grammar of word for- mation for a language like German. A refinement of an RTN-based approxima- tion algorithm ... model of word formation, there are a number of considerations that speak in favor of a finite-state account. (A basic assumption made here is that a morphological analyze...

Ngày tải lên: 23/03/2014, 19:20

... upstream and intron modules, and that of their interactions can be calculated with an approach based on the analysis of variance ( ANOVA ) technique. To normalize the data, the activity of reference ... R.H., van den Bogaert, A. J.W., Das, A. T., van Oorschot, D .A. J., Frijters, C., Charles, R., Moorman, A. F.M. & Lamers, W.H. (1990) Isolation and characterization of the...

Ngày tải lên: 23/03/2014, 20:22