Báo cáo sinh học: "Etiology and antibiotic resistance patterns of community-acquired urinary tract infections in J N M C Hospital Aligarh, India" potx

... Antimicrobials Open Access Research Etiology and antibiotic resistance patterns of community-acquired urinary tract infections in J N M C Hospital Aligarh, India Mohammed Akram 1 , Mohammed Shahid 2 and Asad ... used antimicrobilas among pathogens of both bacteremic and non-bacteremic community-acquired urinary tract infec- tion. J Microbial Imm...

Ngày tải lên: 08/08/2014, 19:20

... feed- ing methods [37], the impact of the infant feeding compo- nent of the pMTCT programme on infant feeding outcomes is uncertain. Limitations In interpreting the findings of the present study, ... guidelines at the international and national level, infant feeding counselling remains a major challenge and a controversial issue in pMTCT in Tanzania [2]. A qualitative study i...

Ngày tải lên: 18/06/2014, 17:20

... interest in receiving official or administrative information and 40% were interested in reading clinical (tibbi maalooomat) information, while 57% wanted both types of information in equal amounts through ... sufficient. Communicating with males on family planning; estab- lishing village health committees; convincing TB suspects to make use of diagnostic facilities; and talking...

Ngày tải lên: 18/06/2014, 17:20

... Robinson J, Posner M, Sodroski J: Functional and immunologic characterization of human immunodeficiency virus type 1 envelope glycopro- teins containing deletions of the major variable regions. ... Learmont J, Tindall B, Evans L, Cunningham A, Cunningham P, Wells J, Penny R, Kaldor J, Cooper DA: Long-term symptomless HIV- 1 infection in recipients of blood products from a sin...

Ngày tải lên: 18/06/2014, 18:20

... Kleijn DPV, Coenen T, Laverdure AM, Tensen CP & Vanherp F (1992) Localization of messenger RNAs encoding crustacean hyperglycemic hormone and gonad inhibiting hormone in the X-organ sinus gland ... neurohormones, such as moult-inhibiting hormone, mandibular organ inhibiting hormone and vitellogenesis inhibiting hormone (VIH; also called gonad inhibiting hormone) [20]. In Homarus...

Ngày tải lên: 18/02/2014, 11:20

... CTCTCCACACTCTTCCATCCTCCAAAGGCGGTGCCTTTCCATGTGCGTC Adh3 Adh3 (class III Adh) Rat GACACTCTCCACACTCTTCCAGCCTCCAAAGGCAGTGCCTTTCCACGTG Adh4 Adh4 (class IV Adh) Mouse TCATCTCTGCTCTTCCACCCTCCAAAGACGCAGCCCTTCCACGTACGCC Adh4-1 Adh4 (class ... CCCAGCACAGAACACCCAGCTCTCTGGATCTCAAAATGTCAGGACAGTCCG Adh4-2 Adh4 (class IV Adh) Rat CATCATCTCTGCTCTTCCAACCACCAAAGACGCAGCCCTTCCATGTCCG Adh4-3 Adh4 (class IV Adh) R...

Ngày tải lên: 16/03/2014, 11:20

... the presence of a noninducing, nonrepressing (NINR) medium, such as glycerol or raffinose, the GAL switch is in a noninduced state. Under such a condition, KlGal4p activity is inhibited by the binding ... maximum b-galactosidase concentration obtained in glycerol medium. A typical experimental run that aimed to maintain a constant glucose concentration of 57 ± 4mm is shown in Fig. 4A...

Ngày tải lên: 29/03/2014, 09:20

... poor planning, and ignorance from the local government were mentioned as main reasons for inadequate staffing. FGD participants were concerned with lack of good training institutions and training programs, ... CPH directors' judgment on various statements about HR policy, management, and funding issues in their CPH Statements about HR policy, management, and funding issues i...

Ngày tải lên: 18/06/2014, 17:20

... p1259A and cdc2503B in this study covered 1239 nucleotides encoding 413 amino acids, including portion of domain I and II, 3 hinge regions, and complete domain III to the end of the stem-anchor ... it contained 293 amino acids, ranging from E118 to E412, which include portions of domain I Strategy in clonal-sequencing the whole genome of genomic RNA of DENV-3Figure 1 Strat...

Ngày tải lên: 19/06/2014, 08:20

... postweaning growth in mice. Genet Res Camb 44, 293-308 Dickerson GE (1973) Inbreeding and heterosis in animals. In: Proc Anim Breeding Genet Sym P in honour of Dr JL Lush, ... in F2 and backcrosses. Since that time, a number of crosses between homozygous lines and even between heterogeneous subpopulations have been conducted in plants...

Ngày tải lên: 09/08/2014, 18:21