Báo cáo sinh học: "Mycobacterium avium subsp. paratuberculosis linked to Crohn''''''''s Disease and Paratuberculosis" pot

... from, and complement, tradi- tional community health worker training? ã How can the health professional training be better aligned with local health needs and be more socially accountable? ã What ... the status of existing collaborations between developing countries aiming to improve health worker education? ã How have modifications in healthcare management had an impact u...

Ngày tải lên: 18/06/2014, 17:20

... WHO Department of Human Resources for Health and former Minister of Health for the Philippines to launch the feature with an opening editorial to be found in the journal's blog. This opening article ... systems of leading and managing human resources for health do not work in today's context. In these cases and others, a more appropriate mode of leadership, linke...

Ngày tải lên: 18/06/2014, 17:20

... Kukasha W, Ahoua L, Le Paih M, Munger A, Kabwinja A, Mpunga J, Chazel E, Jeannin A, Szumilin E, Kamoto K, Harries A: Nurses and medical assistants taking charge: task -shifting HIV care and HAART ... Impact of task -shifting and joint efforts in the provision of care and antiretroviral treatment to infants and children in a resource constrained setting. AID...

Ngày tải lên: 18/06/2014, 17:20

... STU D Y Open Access Sharing best practices through online communities of practice: a case study Annamma Udaya Thomas 1* , Grace P Fried 2 , Peter Johnson 1 , Barbara J Stilwell 3 Abstract Introduction: ... developmental status of students, allocation of scarce clinical and academic resources, space within an already crowded program of study and clinical compe- tency...

Ngày tải lên: 18/06/2014, 17:20

... available soon. The human resource for health situation in Zambia: deficit and maldistribution Human Resources for Health 2011, 9:30 doi:10.1186/1478-4491-9-30 Paulo Ferrinho (pferrinho@ihmt.unl.pt) Seter ... train, retain. The AIDS and health workforce plan. Report on the consultation on AIDS and human resources for health. WHO, Geneva, May 2006. 2...

Ngày tải lên: 18/06/2014, 17:20

... to examine the human neuronal cell protein responses to NiV infection. Results Comparison of 2D-PAGE protein profiles of NiV-infected SK-N-MC cells The NiV-infected and mock-infected human neuronal cells ... present study, we examine the human neuronal cell protein responses to NiV infection and compare it to that of the mock-treated cells. The focus on neu...

Ngày tải lên: 18/06/2014, 18:20

... TCATTCGACGCCATCTTCATT (5084–5104) - 4290 F TCACTATGATGCTGATTACTC (4282–4302) - NLV1S25F GTGAATGAAGATGGCGTCTAACGAC (1–25) + NEWRACE ATAGCAATTGTTGTCAAAGGCTGTGTAAGGGAACG (588–622) - Virology Journal 2007, ... 481 A 540 BAF38397 480 P A 539 AAL18873 481 Y P V 540 AAD40497 480 P A 539 AAT12693 480 P A 539 AAD40488 480 P A 539 AAT12696 480 P A 539 AAL79839 480 P A 539 AAL1887...

Ngày tải lên: 18/06/2014, 18:20

... 1 of 5 (page number not for citation purposes) Virology Journal Open Access Research Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix Shuzo Urata 1,2,3 , Hideyoshi Yokosawa 3 and ... mechanism of HTLV-1 budding in detail, we analyzed HTLV-1 budding using dominant negative (DN) forms of the class E proteins. Results: Here, we report that DN for...

Ngày tải lên: 18/06/2014, 18:20

... ECTV and tropomyosin within the cell. Subsequent immunofluorescence studies exam- ining the association of ECTV-PH, tropomyosin, and ATI proteins with viral membrane proteins and actin, and examining ... citation purposes) Virology Journal Open Access Research An ectromelia virus profilin homolog interacts with cellular tropomyosin and viral A-type incl...

Ngày tải lên: 18/06/2014, 18:20

... Parkinson's disease (PD) and Huntington's disease (HD), but gait dynamics in mouse models of PD and HD have not been described. Here we quantified temporal and spatial indices of gait dynamics ... studies of gait and gait variability in mouse models of PD, HD, and ALS. Competing interests Thomas G. Hampton is owner of Mouse Specifics...

Ngày tải lên: 19/06/2014, 10:20

... n AOA,i is the noise in r AOA,i .Equation(14) can also be expressed in vector form as r AOA = f AOA (x)+n AOA , (15) where r AOA =  r AOA,1 r AOA,2 ···r AOA,M  T , n AOA =  n AOA,1 n AOA,2 ···n AOA,M  T , f AOA (x) ... {n TDOA,i }, {n RSS,i } ,and{ n AOA,i } are sufficiently small and are modeled as zero-mean Gaussian random variables with known covariance matrices, denoted by C n,TOA , C...

Ngày tải lên: 22/06/2014, 23:20

... Mycobacterium avium subsp. paratuberculosis linked to Crohn's Disease and Paratuberculosis Stefania Zanetti 1,2 , Paola Molicotti 1 , Sara Cannas 1 , Silvia Ortu 1 , Niyaz Ahmed 2,3 and Leonardo ... Background Crohn's disease, a human disease similar to paratubercu- losis in animals is the most painful and devastating dis- ease that may involve infection...

Ngày tải lên: 08/08/2014, 19:20

... granulomas and epithelioid histiocytes. Melkersson-Rosenthal syndrome (a triad of orofacial swelling, facial paralysis and a fissured tongue) is one manifestation of orofacial granulomatosis, ... commonly presents as granulomatous cheilitis alone [5-10]. Most reported cases of orofacial granuloma- tosis have been in adults and some in adolescents. Orofa- cial granulomatosis in the...

Ngày tải lên: 11/08/2014, 11:20

... Access Successful treatment of HIV-associated multicentric Castleman’s disease and multiple organ failure with rituximab and supportive care: a case report Robin H Johns 1* , Tomas Doyle 2 , Marc ... report the case of a 46 year old Zambian woman who presented with pyrexia, diarrhoea and vomiting, confusion, lymphadenopathy, and renal failure....

Ngày tải lên: 11/08/2014, 14:21

... population. Evolution 40, 740-755 Original article The evolutionary history of Drosophila buzzatii. XVII. Double mating and sperm predominance A Barbadilla JE Quezada-Díaz, A Ruiz M ... in males and double mating in females have been studied in 2 stocks of the cactophilic species Drosophila buzzatii. The relationship between double mat...

Ngày tải lên: 14/08/2014, 20:20