Báo cáo khoa học: "Performance and morphological response of the hybrid poplar DN-74 (Populus deltoides x nigra) under different spacings on a 4-year rotation" pps

Báo cáo khoa học: "Performance and morphological response of the hybrid poplar DN-74 (Populus deltoides x nigra) under different spacings on a 4-year rotation" pps

Báo cáo khoa học: "Performance and morphological response of the hybrid poplar DN-74 (Populus deltoides x nigra) under different spacings on a 4-year rotation" pps

... indicates that, even though the Original article Performance and morphological response of the hybrid poplar DN-74 (Populus deltoides x nigra) under different spacings on a 4-year ... content data, except that the repeated measurement component (γ n) was excluded. Linear regression analysis of SLA as a function of nu...

Ngày tải lên: 08/08/2014, 14:21

13 230 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... and aberrant promoter methylation of GPR150, ITGA8 and HOXD11 in ovarian cancers. Life Sci 80, 1458–1465. 9 Suzuki E, Imoto I, Pimkhaokham A, Nakagawa T, Kamata N, Kozaki KI, Amagasa T & Inazawa ... solutions. The ligand bound was interpreted as GMP because the N2 of the base makes a hydrogen bond to a main chain car- bonyl. Binding of a xanthine base from XMP in t...

Ngày tải lên: 15/02/2014, 01:20

11 770 0
Tài liệu Báo cáo khoa học: Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus pdf

Tài liệu Báo cáo khoa học: Structure and membrane interaction of the internal fusion peptide of avian sarcoma leukosis virus pdf

... at low pH. Taken together, these data and the model of Matsuyama et al . [24] are suggestive of the idea that deeper membrane insertion induced by acidic pH facilitates fusion of both inner and ... -aHcross-peaksinD/H exchange and Mn 2+ relaxation enhancement experiments. The standard error in computing signal attenuation is 5%. Mo re exposed backbone amide proton results in...

Ngày tải lên: 19/02/2014, 16:20

12 590 0
Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc

Tài liệu Báo cáo khoa học: Bioinformatic and enzymatic characterization of the MAPEG superfamily doc

... primer, 5¢-GAGA GAGGATCCATATGACAAAAACCGAGTTAC-3¢, NdeI site; antisense primer, 5¢-GAGAGAAAGCTTCAAAACT GGGACAGTTG-3¢, HindIII site. The same method was used to amplify the coding sequence for the E.coliMGST, ... transferase: functional and evolutionary implications. Structure 6, 721–734. 17 Kaneko T, Tanaka A, Sato S, Kotani H, Sazuka T, Miyajima N, Sugiura M & Tabata S (1995) Seq...

Ngày tải lên: 19/02/2014, 17:20

16 525 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

... 5–8). The pK a of Asp140 is much lower than that of Asp142 and Glu144 in all situations where all three residues are present and the one proton shared by Asp140 and Asp142 appears to remain on Asp142 ... with partial charges being formed, and covalent bonds being formed and broken). Thus, the calculated effect of rotation of Asp142 on the pK a of Glu144 onl...

Ngày tải lên: 07/03/2014, 14:20

10 652 0
Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx

... GAATCATTATGAAGCGGTGAGAGCTAATTTTGAAGG TGCTCGTACGCTGCAGGTCGAC KU1012 TATTTACAAATTTACCTATACGCTCTGAGTTGATATTAC ATCGATGAATTCGAGCTCG KU1130 GCTAATAACAACTAATATCACTAACAGAAGACCATTAC CCCGTACGCTGCAGGTCGAC KU1131 GGAGGATTTATCAAAAGCTACTTCGAAAGCTAGGAACG AACGTACGCTGCAGGTCGAC KU1132 ... CGGATCCATGGTTAAAGATATTATCGAAAGGCATTTGC KU617 CCGCATGCGGCCGCTCAAGATGGTGTAAACGCACTAA GCG KU718 CACTAGCAGAACGTACTACGGTGTGGTTTA...

Ngày tải lên: 07/03/2014, 16:20

12 584 0
Báo cáo khoa học: Spectroscopic and kinetic properties of the horseradish peroxidase mutant T171S Evidence for selective effects on the reduced state of the enzyme potx

Báo cáo khoa học: Spectroscopic and kinetic properties of the horseradish peroxidase mutant T171S Evidence for selective effects on the reduced state of the enzyme potx

... absorbance change at satura- tion (A 1 ) to float. Resonance Raman and electronic absorption spectroscopy For resonance Raman and electronic absorption spectro- scopy the experimental conditions ... depends on a number of other factors such as the electro- static, Van der Waals and hydration status of the haem environment that also vary with the peroxidase under consid...

Ngày tải lên: 07/03/2014, 21:20

8 543 0
Báo cáo khoa học: Functional and genetic characterization of the promoter region of apolipoprotein H (b2-glycoprotein I) ppt

Báo cáo khoa học: Functional and genetic characterization of the promoter region of apolipoprotein H (b2-glycoprotein I) ppt

... 1770–1776. 7 Wang HH & Chiang AN (2004) Cloning and character- ization of the human beta2-glycoprotein I (beta2-GPI) gene promoter: roles of the atypical TATA box and hepatic nuclear factor-1alpha in ... occur at various stages, including the level of transcription, post-transcriptional regulation, alternative splicing, translation, post-translational modification and sec...

Ngày tải lên: 15/03/2014, 10:20

13 404 0
Báo cáo khoa học: Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus – the role of conserved residues in the active site pdf

Báo cáo khoa học: Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus – the role of conserved residues in the active site pdf

... 5¢-GCCACT TACTTGAACTTTGACATAGAAGCCGG-3¢,5¢-GCCAC TTACTTGGCATTTGACATAGAAGCC-3¢,5¢-GCCACT TACTTGGACTTTAACATAGAAGCCGG-3¢,5¢-GCCAC TTACTTGGACTTTGCGATAGAAGCCGG-3¢,5¢-GGAC TTTGACATACAAGCCGGTATCGATGC-3¢,5¢-GGACT TTGACATAGCGGCCGGTATCGATGC-3¢ and 5¢-GGA TCACTAGCCTTCGCGAGTGTAGACAGAG-3¢, ... k-uegaki@aist.go.jp Database Structural data are available at the Protein Data Bank under the accession n...

Ngày tải lên: 15/03/2014, 11:20

13 514 0
Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx

Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx

... medium and K 2 the orientation factor, determined by the mutual spa- tial orientation of the transition dipole moments of the donor and acceptor. As no data on the spatial orientation of the transition ... helical content at the expense of random coil mainly. Helical content reached 78% in the presence of caprylic acid, indica- ting additional stabilization of...

Ngày tải lên: 16/03/2014, 18:20

10 501 0
Từ khóa:
w