Báo cáo khoa học: "Mineral nutrient concentrations in sapwood and heartwood: a literature review" ppt

... [50] and Ziegler Mineral nutrients in wood 715 Table I. Mineral element concentrations in heartwood and sapwood and heartwood /sapwood concentration ratio: mean values ± standard deviation for Angiosperms ... heartwood /sapwood concen - tration ratio decreases with increasing sapwood concentrations. Finally ,a& gt;1points to an increase in heartwood /sapwood concen - tr...

Ngày tải lên: 08/08/2014, 14:21

... understand- ing provides insight into potential errors (bias and random error) related to data based on clinical examina- Acta Veterinaria Scandinavica 2009, 51:36 http://www.actavetscand.com/content/51/1/36 Page ... decision making procedures and motivation to collect data are so different. Conclusion Variation and bias in data based on clinical examinations can be linked to veterina...

Ngày tải lên: 25/10/2012, 10:45

... X-linked agammaglobulin- emia. A clinical and molecular analysis. Medicine (Baltimore) 75, 287–299. 27 Plebani A, Soresina A, Rondelli R, Amato GM, Azzari C, Cardinale F, Cazzola G, Consolini ... ITK and the gain-of-function fusions ITK–SYK and BTK–SYK Alamdar Hussain 1,2, *, Liang Yu 1,3, *, Rani Faryal 1,2 , Dara K. Mohammad 1 , Abdalla J. Mohamed 1,4 and C. I. Edvard Smith 1 1...

Ngày tải lên: 14/02/2014, 18:20

... Sidi S, Yan YL, Postlethwait JH, Mullins M, Rosa F & Peyrieras N (2002) Cooperative action of ADMP- and BMP- mediated pathways in regulating cell fates in the zebra- fish gastrula. Dev Biol ... head formation and promotes trunk formation [10]. Although admp may cooper- ate with bmp2b or bmp7 in establishing dorsoventral regionalization, ADMP appears to act through a different s...

Ngày tải lên: 19/02/2014, 00:20

... and CK on an in- domain evaluation (ETHICS-domain) using different amounts of labeled training data. We carry out a 5-fold cross-validation and use n% of the train- ing data in the training folds. ... both recall and precision if few training data are used. The impact on precision decreases, however, the more training data are added. There is always a significant increase in rec...

Ngày tải lên: 22/02/2014, 02:20

... categorisation and machine translation. Finally, the annotations are stored in a fusion data store, comprising of relational database and high-performance Lucene 4 indexes. The architecture ... Consulting SA adamp@ipipan.waw.pl raxis@atlantisresearch.gr Dan Cristea Universitatea Alexandru Ioan Cuza dcristea@info.uaic.ro Abstract The emergence of the WWW as the ma...

Ngày tải lên: 22/02/2014, 03:20

... 2005) doi:10.1111/j.1742-4658.2005.04946.x The wealth of available genomic data has spawned a corresponding interest in computational methods that can impart biological meaning and context to these experiments. Traditional computational ... molecules and interactions that govern all biological functions and disease proces- ses. Simple pairwise associations between proteins and bet...

Ngày tải lên: 07/03/2014, 21:20

... CCTCAGGTGCATGGACCAAC Ctsc GAAGTTCCCGAAGCGACATTA CACCTTCTTGCCAACAAAGC Gpr49 AATCGCGGTAGTGGACATTC GATTCGGAAGCAAAAATGGA Nr1i3 AACAACAGTCTCGGCTCCAAA AGCATTTCATTGCCACTCCC Ahr GTCAAATCCTTCTAAGCGACACA AACCAGCACAAAGCCATTCA Hes1 ... ATTGAACTGACAGACTCGCCCTAT TTCCCACCATATCCGCTTCC Cyp 1a2 GAGCGCTGTATCTACATAAACCA GGGTGAACATGATAGACACTATTGT Cyp2e1 TCCCTAAGTATCCTCCGTGA GTAATCGAAGCGTTTGTTGA Cyp2f2 AAAGAAGCATC...

Ngày tải lên: 23/03/2014, 10:20

... equiva- lents that were eliminated due to the noise present in the automatically generated training data. We manually examined all keywords that had a P (spec) > 0.5 given as a standalone instance ... bi-, and trigrams altogether. This efficient way of reranking and selecting po- tentially relevant features (we managed to discard 89.5% of all the initial candidates automatically)...

Ngày tải lên: 31/03/2014, 00:20

... Artificial Intelligence and Tutoring Systems. Morgan Kaufmann, Los Altos, CA. 890 ungrammatical input? How to implement teaching strategies that are appropriate for language learning? These are ... (1992) An Introduction to Machine Translation, Academic Press, San Diego, CA, 361 p. Ingraham, B., Chanier T. & Emery,C. (1994) CAMILLE: A European Project to Develop Language Tra...

Ngày tải lên: 31/03/2014, 04:20