Báo cáo khoa học: "Towards construction of an ultra high density linkage map for Pinus pinaster" pdf

... Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases Juha P. Kallio 1 , Chiara Gasparetti 2 , Martina Andberg 2 , ... Several crystal structures of laccases from fungi and bacteria are available, but ascomycete types of fungal laccases (asco-lac- cases) have been rather unexplored,...

Ngày tải lên: 14/02/2014, 18:20

... amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, ... Journal 276 (2009) 59835997 ê 2009 The Authors Journal compilation ê 2009 FEBS Functional characterization of an orphan cupin protein from Burkholderia xenovorans...

Ngày tải lên: 18/02/2014, 06:20

... Complete reconstitution of an ATP-binding cassette transporter LolCDE complex from separately isolated subunits Kyoko Kanamaru* , , Naohiro Taniguchi, Shigehiko Miyamoto, ... complete reconstitution system of the LolCDE complex from isolated subunits, it seemed important to examine in detail the stability of LolD and LolCDE in a DDM solution. The...

Ngày tải lên: 19/02/2014, 00:20

... Journal 273 (2006) 257270 ê 2005 FEBS 261 A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio Role of the seventh histidine and accessibility to the active site Diana Herna ´ ndez-Romero 1 , ... repor- ted the existence and expression of a multipotent lac- case and a tyrosinase in Marinomonas mediterranea [11,13...

Ngày tải lên: 19/02/2014, 07:20

... of reviews are not available. In addition, the corpus created from re- views is often noisy as we discuss in Section 2. This paper proposes a novel method of building polarity-tagged corpus from ... proposes a novel method of building polarity-tagged corpus from HTML documents. The characteristics of this method is that it is fully automatic and can be applied to arb...

Ngày tải lên: 20/02/2014, 12:20

... terms made up of multiple words, rather than just using the head nouns of the noun phrases. 124 Automatic construction of a hypernym-labeled noun hierarchy from text Sharon A. Caraballo Dept. ... judges. For any noun that was not evaluated by at least two judges, we evaluated the noun/ hypernym pair by examining the appearances of that noun in the source t...

Ngày tải lên: 08/03/2014, 06:20

... objective translations for the rule writer. Therefore, the rewritten translations were acquired by translating trained sentences by TDMT. 157 Automatic Construction of Machine Translation Knowledge Using ... effect of literalness in MT knowledge construction, we constructed knowl- edge by using the methods described in Section 5 and evaluated the MT quality of the result...

Ngày tải lên: 08/03/2014, 21:20

... by complements like Mr., Co., Inc. etc. An initial implementation of this idea resulted in the resolution of .53% (26/49) of the cases based on names. Some relations are not found in WN, for ... relations, dis- tributed over 107 cases of DDs. There were 54 cor- rect resolutions (distributed over 34 DDs) and 186 false positives. Types of bridging definite descriptions A...

Ngày tải lên: 08/03/2014, 21:20

... member of a unique branch of the kinome in which downstream signaling occurs in both ligand- and receptor- expressing cells. Consequently, the ephrins and ephrin receptor tyrosine kinases often ... School of Medicine, New Haven, CT, USA Introduction The ephrin receptor class of receptor tyrosine kinases (EPH RTKs) is the largest subgroup of RTKs in the k...

Ngày tải lên: 16/03/2014, 02:20

... FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation Yutaka Suzuki, Mitsuru Haruki*, Kazufumi Takano, Masaaki Morikawa and Shigenori Kanaya Department ... Kanaya Department of Material and Life Science, Graduate School of Engineering, Osaka University, Japan A psychrotrophic bacterium Shewanella sp. strain S...

Ngày tải lên: 16/03/2014, 16:20

... to a mechanized system; of translation, and of out- put are interpreted in terms of an operational machine translation center. The use of machines to do high-volume, high-speed translation ... disciplines, expansion of the center to greater capacity, or the creation of 110 [ Mechanical Translation , Vol.6, November 1961] The Parameters of an Operationa...

Ngày tải lên: 16/03/2014, 19:20

... Osteopontin and osteopontin-like gene and protein struc- ture. (A) Structural organization of osteopontin-like (tetraodon and zebrafish) and osteopontin (chicken, bovine, mouse and human) coding sequences ... OP-L protein is indeed the fish equivalent of mammalian osteopontin. OP-L protein plays a role in the process of mineralization Osteopontin is a multifaceted protein...

Ngày tải lên: 23/03/2014, 07:20

... is used in both the timber and pulp industries, involving differ - ent partners (forest owners, timber and pulp industrials) for whom different traits may be of interest. Today, the maritime pine ... parameters including heritabilities and genetic correlations are presented and a breeding strategy for the utilisation of maritime pine wood for timber and pulpi...

Ngày tải lên: 08/08/2014, 14:20

... which consist of an integrated linkage map derived from two P. pinaster genotypes and some associations of linkage groups of our map with those of different pine species. 2. MATERIALS AND METHODS 2.1. Plant ... one or more segregating bands. 3.2. Construction of linkage maps Initially, individual linkage maps of 12 linkage groups each were obtained for the two...

Ngày tải lên: 08/08/2014, 14:20

... 7:18 http://www.globalizationandhealth.com/content/7/1/18 Page 4 of 7 REVIEW Open Access The economics of health and climate change: key evidence for decision making Guy Hutton Abstract Background: In responding to the ... economics of health and climate change: key evidence for decision making. Globalization and Health 2011 7:18. Hutton Glob...

Ngày tải lên: 11/08/2014, 14:21