Báo cáo khoa học: "Efficient wood and fiber characterization – A key factor in research and operation " pot

Báo cáo khoa học: "Efficient wood and fiber characterization – A key factor in research and operation." pot

... LundqvistEfficient wood and fiber characterization Original articleEfficient wood and fiber characterization – A key factor in research and operation Sven-Olof Lundqvist*STFI, Swedish Pulp and Paper Research ... char-acterization and modeling, as well as experiments in thelaboratory, in a pilot plant and in mills. Many properties of wood and fibers are being measured at several levels of de-tail.The ... Wood disc and the total widths and latewood band widths of all annual rings in two directions. In this case, limits for juvenile, youngmature and mature wood have been set at rings 1 5and 30respectively....

Báo cáo khoa học: Stimulation of ﬁbroblast proliferation by neokyotorphin requires Ca2+ inﬂux and activation of PKA, CaMK II and MAPK/ERK pdf

... mitogen-activated protein ⁄ extracellularsignal-regulated kinase kinase ⁄ extracellular signal-regulated kinase and nuclear factor kappaB pathway and cellular transformation. Cancer Res 64, 342 8– 3435.50 ... results indicate that Ca2+ in ux via theL-type channel and an increase in intracellular Ca2+levels are involved in the action of neokyotorphin in L929 ﬁbroblasts.Protein kinases involved in the ... system. PKA may activatethe Ca2+L-type channel, resulting in an increase in the Ca2+ in ux, elevation of the intracellular Ca2+level and CaMK II activation. A generalized schemeof the action...

Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt

... CGGGACGGTGTTGAGAGTGGACXCL12.rv5 GAGAGTGGACCGGCACCAACAqCXCL12b.fw1 GAGGAGGACCACCATGCATCTqCXCL12b.rv1 TTGTGCAAGCAGTCCAGAAAGACarp CXCL14 AJ536028 CXCL14.rv3 GGATGCAGGCAATACTCCTGCXCL14.fw5 CCATACTGCCAAGAAAAGATGATqCXCL14.fw1 ... CAACAGGGAAAAGATGACACAGATCqACT.rv1 GGGACAGCACAGCCTGGATVector T7 TAATACGACTCACTATAGGGT3 CGCAATTAACCCTCACTAAAGÓ FEBS 2004 Three novel carp CXC chemokines (Eur. J. Biochem. 271) 4095phagocytes ... CACCGTCACAGATATGTACCATATAGTCqCXCL1 2a. rv1 GGTGGTCTTTTGCAGAGTCATTTCarp CXCL12b AJ536027 CXCL12.rv1 TTCTTTAGATACTGCTGAAGCCACXCL12.fw3 AGGTCTGCATCAACCCCAAGCXCL12.fw4 GCATCAACCCCAAGACCAAATGGCXCL12.rv4 CGGGACGGTGTTGAGAGTGGACXCL12.rv5...

Báo cáo khoa học: Mechanism for transcriptional synergy between interferon regulatory factor (IRF)-3 and IRF-7 in activation of the interferon-b gene promoter docx

... H., Hata, N ., Asagiri, M., Ogasawara, K.,Nakao, K., Nakaya, T., Katsuki, M., Noguchi, S., Tanaka, N. &Taniguchi, T. (2000) Distinct and essential roles of transcriptionfactors IRF-3 and ... transfection.CAT and b-galactosidase activities were measured in extracts of transfected cells [24], and CAT activitywas expressed in arbitrary units after normalization tob-galactosidase activity ... tran-scriptional machinery and transcriptional activation [11].Besides virus infection, many stressing or in ammatorystimuli can coordinately activate members of the AP-1, IRF and Rel families...

Báo cáo khoa học: High-resolution crystal structures of the ﬂavoprotein NrdI in oxidized and reduced states – an unusual ﬂavodoxin pot

... with apoﬂavodoxin: a sensitive assay for riboﬂavin5¢-phosphate and ﬂavin adenine dinucleotide in mix-tures. Anal Biochem 68, 60 9–6 16.R. Johansson et al. NrdI – an unusual ﬂavodoxinFEBS Journal ... CONSOLIDER(CSD2008-00013) and ERANET Pathogenomics.Wewish to thank Maria Ha˚kansson for help at the MAX-lab crystallization facility and the staff at beamlineI911 at MAX-lab for assistance with data collection.We ... FMN cofac-tor and the 40s loop. Residues within 4 A ˚of FMN that makeinteractions with it are shown as thin lines. Particularly relevantside chains, including all acidic side chains in the...

Báo cáo khoa học: "Early clinical experience with volumetric modulated arc therapy in head and neck cancer patients" ppsx

... Switzerland.Authors’ contributionsMS and AF coordinated the entire study. Patient accrual and clinical datacollection was done by MS, SC, CB, MB, PN, SP. Data analysis, physics data and treatment ... data of Group A and Bwere analyzed together; presenting irradiation of similaranatomical regions, while Group C was kept separatedinvolving the sinonasal region only, and not the neckareas.Technical ... mask.Table 1 Summary of patients characteristics attreatment startNumber of patients 45Site Oral CavityNasopharynxOropharynxHypopharynxLarynxNasal Cavity and ParanasalSinusesOther731611062Histology...

Báo cáo khoa học: "The alkylphospholipid, perifosine, radiosensitizes prostate cancer cells both in vitro and in vivo" docx

... were purchased from Harlan Laboratories, Inc.(Indianapolis, Indiana). Animals were kept and handledunder a 12h/12h light/dark cycle at 22°C, received a standard diet and acidified water. Mice ... Guangzhou,China.6Department of Radiology and Radiation Oncology, Kitasato UniversitySchool of Medicine, Sagamihara, Kanagawa, Japan.7Cancer Hospital, ChineseAcademy of Medical Sciences and Peking Union Medical College, ... Bellacosa A, de Feo D, Godwin AK, Bell DW, Cheng JQ, Altomare DA,Wan M, Dubeau L, Scambia G, Masciullo V, et al: Molecular alterations ofthe AKT2 oncogene in ovarian and breast carcinomas. Int...

Tài liệu Báo cáo khoa học: "Generalized Hebbian Algorithm for Incremental Singular Value Decomposition in Natural Language Processing" potx

... the dataset makes conventional batchapproaches infeasible. It is also of interest in the context of adaptivity, since it has the po-tential to adapt to changing input. The learn-ing update operation ... eigenvectors of A ∗ A T and A T∗ A, r espectively, and the singular values,Σ, are the square-roots of the correspondingeigenvalues.2.1 Generalised Hebbian AlgorithmOja and Karhunen (Oja and Karhunen, ... expectation of a random matrix. J. Math.Analysis and Application, 10 6:6 9–8 4.Terence D. Sanger. 1989. Optimal unsupervisedlearning in a single-layer linear feedforward neu-ral network. Neural Networks,...

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

... for inverted terminal repeat ampliﬁcation were:1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGCATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATTTable 1. Primers and ... muscleremodelling in skeletal muscle.AbbreviationsAAV2/1, adeno-associated virus 2/1; Ankrd2, ankyrin repeat domain-containing protein 2; CARP, cardiac ankyrin repeat protein; DAPI,4¢,6-diamidino-2-phenylindole; ... CGCTTTCGGAGGTGCTTTCGCAGM1941p65.R: TCAGAGTTCCCTACCGAAGCAGP0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGAM225PO.P: CCGTGGTGCTGATGGGCAAGAAM267PO.R: ACCATGATGCGCAAGGCCATp21WAF1/CIP1Cyclin-dependent...

Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc

... kDa. EachPKG monomer harbors several different functionaldomains associated with their respective N-terminal,regulatory and C-terminal, catalytic subdomains. Theregulatory domain contains a ... the intensity increasedbetween 0 and 4 m urea and later decreased againbetween 4 and 8 m urea. A clear shift in maximal emis-sion wavelength (MEW) between the native and thefully denatured ... spectra of PKG Ia in the absence (A) and presence (B) of cGMP at native(0M) and fully denatured (8 M) states, and partially denatured states at 2-M intervals.Lines represent average spectra (n...

Xem thêm