Báo cáo khoa học: "Within crown variation in hydraulic architecture in beech (Fagus sylvatica L): evidence for a stomatal control of xylem embolism" docx

... p. Stomatal control of embolism in Fagus 27D. Lemoine et al .Stomatal control of embolism in FagusOriginal articleWithin crown variation in hydraulic architecture in beech (Fagus sylvatica L): ... in vascular plants [24]. A large stomatal opening that induces transpiration is a necessary conse-quence of the plant’s need to maintain gas exchange in leaves for photosynthesis. To maintain ... gs values decreased drastically for Ψ values close to the values of Ψcav for the two kind of branches. Shade and sun branches presented an early stomatal regulation during drying and stomatal...

Báo cáo lâm nghiệp: "Within-crown variation in leaf conductance of Norway spruce: effects of irradiance, vapour pressure deficit, leaf water status and plant hydraulic constraints" ppt

... in an Arizona pine-oakforest, Tree Physiol. 20 (2000) 1–12.[17] Lemoine D., Cochard H., Granier A. , Within crown variation in hydraulic architecture in beech (Fagus sylvatica L): evidence for ... evaporativedemand (Tab. V). Our results point to the dominant role of a tree hydraulic capacity in determining patterns of stomatal beha-viour in spruce trees. In addition to maintaining a ... transport capacity of the stem maintains leaf water statusremarkably constant over a wide range of environmental con-ditions. For a given soil-to-leaf hydraulic conductance, thevalue of stomatal conductance...

Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc

... (CAGGACAGCCTGCGCAACGAG), RVR (CAGGACAGGGTGCGCAACGAG), SVR (CAGGACAGCGTGCGCAACGAG) and SLC (AGGGTATCCCTCTGCGATACG), respectively. All the alleles were inserted in pCW between the NdeIandXbaI ... thestability of the protein was affected by each of the mutationsTable 4. Apparent a nity of DDT and testosterone for CYP 6A2 wt andCYP 6A2 vSVL. For each apparent a nity calculated, the mean ± SDand ... Escheri-chia coli as well as three variants carrying a single mutation,the double mutant CYP 6A2 vSV and the triple mutantCYP 6A2 vSVL. All CYP 6A2 variants were less stable thanthe CYP 6A2 wt protein....

Tài liệu Báo cáo khoa học: An immunomodulator used to protect young in the pouch of the Tammar wallaby, Macropus eugenii pptx

... University of AdelaideAnimal Ethics Committee.Acetylcholine, atropine, concanavalin A, CCK-8 andCCK-8-NS were obtained from Sigma-Aldrich. Alamar bluewas obtained from Astral Scientiﬁc (Caringbar, ... Queensland, Brisbane, Queensland, AustraliaMarsupials are born in an immature state and many of the developmental processes that occur in thesemammals take place during pouch life [1]. After a short ... pro-cessing intermediates. Am J Physiol 252, G315–G319.39 Anastasi A, Erspamer V & Endean R (1968) Isolationand amino acid sequence of caerulein, the active peptide in the skin of Hyla caerulea....

Tài liệu Báo cáo khoa học: "Detecting Semantic Equivalence and Information Disparity in Cross-lingual Documents" doc

... Finkel, T. Grenager, and C. Manning. 2005. Incor-porating Non-local Information into Information Ex-traction Systems by Gibbs Sampling. In Proceedings of the 43rd Annual Meeting on Association ... Association for Com-putational Linguistics (ACL 2005).P. Gamallo and I. Gonzalez. 2011. A grammatical for- malism based on patterns of part of speech tags. Inter-national Journal of Corpus Linguistics, ... of LanguageVariability. In Proceedings of the PASCAL Workshop of Learning Methods for Text Understanding and Min-ing.M.C. De Marneffe, B. MacCartney, and C.D. Man-ning. 2006. Generating Typed...

Tài liệu Báo cáo khoa học: "Using Smaller Constituents Rather Than Sentences in Active Learning for Japanese Dependency Parsing" docx

... selection for statisticalparsing. Computational Linguistics, 30(3):253–276.Masakazu Iwatate, Masayuki Asahara, and Yuji Mat-sumoto. 2008. Japanese dependency parsing us-ing a tournament model. In ... Research and Development in Information Retrieval, pages 3–12.Ryan McDonald, Koby Crammer, and FernandoPereira. 2005. Online large-margin training of de-pendency parsers. In Proc. of ACL-2005, pages523–530.Joakim ... and Deryle Lonsdale. 2007. Active learn-ing for part -of- speech tagging: Accelerating corpusannotation. In Proc. of the Linguistic AnnotationWorkshop, pages 101–108.Manabu Sassano. 2002. An...

Tài liệu Báo cáo khoa học: "Mood Patterns and Affective Lexicon Access in Weblogs" ppt

... subset of B for which attribute A is present in the corpus and Bis the subset of B for which attribute A is absent in the corpus.The information gain of an attribute ANEW A in classifying the ... linguis-tic analysis. In this paper we investigate a novel problem of discovering patternsbased on emotion and the association of moods and affective lexicon usage in bl-ogosphere, a representative for ... representatives for the mood fash-ion of sadness and deactivation. In addition, thegrateful group could be a representative for moodswhich are both low in pleasure and in the degree of activation...

Tài liệu Báo cáo khoa học: "Using adaptor grammars to identify synergies in the unsupervised acquisition of linguistic structure" docx

... M of the nonterminals known as the adaptednonterminals.Adaptor grammars achieve this by associatingeach adapted nonterminal A ∈ M with a DirichletProcess (DP). A DP is a function of a base ... there are tree distribu-tions that satisfy the adaptor grammar constraints for recursive adaptor grammars.Inference for an adaptor grammar involves ﬁndingthe rule probabilities θ and the adapted ... string to resample, and sample a parse of thatstring with a PCFG approximation to the adaptorgrammar. This PCFG contains a production for eachadapted subtree in the parses of the other strings...

Tài liệu Báo cáo khoa học: Antioxidant protein 2 prevents methemoglobin formation in erythrocyte hemolysates doc

... recombinant AOP2 were added and the mixtureincubated for an additional hour at 4 °Conarotaryplatform. The supernatants were aspirated after a ﬁnal washand the pellets resuspended in 40 lL of ... mMascorbicacid and containing either 2 lgor7lg of recombinantAOP2 per ml. MetHb formation was measured in these twosamples after they had incubated for 48 and 120 h at 25 °C.MetHb was calculated as ... indicator of the tightinteractions of AOP2 and hemoglobin in RBC. (C) Red blood celllysate was incubated for 1 h at 4 °C on a rotating platform withagarose beads cross linked to hemin, globin,...

Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

... and new information in formulating a paraphrase that differs in a meaningful way from the user's question. A description is also given of the transformational grammar used by the paraphraser ... of given information and no clauses defining specific attributes of the missing information. Clauses containing information characterized by category (3) will be presented as separate sentences ... semantic information is available for the paraphraser's use. Contextual information is also limlte~ since no running history or context is maintained for a user session in...

Xem thêm