Báo cáo khoa học: "A flexible radial increment taper equation derived from a process-based carbon partitioning model" pot

... pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA GCA T) and RGG1 ... primers: KGG3-2 forward d(AAA GGT GGC AAA GGT GGA GAC AGA GGT GGC TT) and KGG3-2 reverse d(GAA CAT TCC ACC GGG ACC ACC AC). pGEX–KGG3-4 was generated by PCR using pGEX–KGG2 as a t...

Ngày tải lên: 15/02/2014, 01:20

... Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity Lorenza Sisinni 1,2 , Laura Cendron 1,2 , Gabriella Favaro 3 and Giuseppe Zanotti 1,2 1 ... expression, and purification The HP1286 gene was amplified by PCR from H. pylori CCUG17874 genomic DNA using the following primers: forward, 5Â-CACCAAACCTTATACGATTGATAA...

Ngày tải lên: 16/02/2014, 14:20

... amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, ... Journal 276 (2009) 59835997 ê 2009 The Authors Journal compilation ê 2009 FEBS Functional characterization of an orphan cupin protein from Burkholderia xenovorans...

Ngày tải lên: 18/02/2014, 06:20

... of the amyloid b-peptide. Proc Natl Acad Sci USA 102, 540 3–5 407. 25 Lemkul JA & Bevan DR (2008) A comparative molecu- lar dynamics analysis of the amyloid b-peptide in a lipid bilayer. Arch ... center of mass and are attracted by contact with the polar back- bone, lipid residues 5 0–6 0 make van der Waals con- tacts with the amino acid side chains of A...

Ngày tải lên: 18/02/2014, 08:20

... The Authors Journal compilation ª 2009 FEBS 4761 Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area Christian Krintel 1,2 , ... surface area upon PKA phos- phorylation. This gain in hydrophobic surface area presumably accounts for the increase in in vitro activity...

Ngày tải lên: 18/02/2014, 11:20

... to Ala eliminated activity in binding to a BPA molecule, and individual mutations drastically reduced the activity. Because Ala lacks the character- istic side chains of Glu and Arg, the mutant ... Glu275Ala, cgg for Glu275Arg, gac for Glu275Asp, and ctg for Glu275Leu); 5Â-TCCTTGGTGTCGTATACxxxTCTCTTTCA-3Â (xxx ẳ gcg for Arg316 fi Ala, aag for Arg316 fi Lys, ctg for Arg31...

Ngày tải lên: 18/02/2014, 16:20

... Mu ă ller V (2007) An intermediate step in the evolution of ATPases – the F 1 F 0 -ATPase from Aceto- bacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis. FEBS ... Journal 275 (2008) 19992007 ê 2008 The Authors Journal compilation ª 2008 FEBS An intermediate step in the evolution of ATPases – a hybrid...

Ngày tải lên: 18/02/2014, 17:20

... ISSUES IN NATURAL LANGUAGE ACCESS TO DATABASES FROM A LOGIC PROGRAMMING PERSPECTIVE David H D Warren Artificial Intelligence Center SRI International, Menlo Park, CA 94025, USA I INTRODUCTION ... permits data to be defined by general rules having the power of a fully general programming language. The logic programming approach therefore allows one to...

Ngày tải lên: 21/02/2014, 20:20

... 2007 FEBS 1611 Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression Attila L. Ne ´ meth 1, *, Pe ´ ter ... above-mentioned ATG codon. Isolation and chemical identification of trypsinogen 4 from human brain Different antihuman trypsinogen 4 mA...

Ngày tải lên: 07/03/2014, 10:20

... caseof a stable profile; points: case of a declining profile. C. Deleuze and F. HoullierA radial increment taper function Original article A flexible radial increment taper equation derived from a ... used to analyse parameter variability in relation with calendar year, silvicultural treatment and fertility. 5.3.1. Amance site The trees are young and each annual s...

Ngày tải lên: 08/08/2014, 14:20

... for records of animals without progeny, thus the only equations needed were those of parent and ancestor animals. A practical application of this ô reduced animal model ằ to swine ... squares to an animal model G.F.S. HUDSON Department of Animal Sciences, University of Maryland, College Park, Maryland 20742, U.S.A. Summary The animal...

Ngày tải lên: 09/08/2014, 22:22

... cor- nea and lens will reduce the overall refractive power of the Change in lens position after topical latanoprostFigure 2 Change in lens position after topical latanoprost. Photographs before latanoprost ... ciliary body thickness after topical application of pharmacogic agents. Am J Ophthalmol 1996, 121:319-321. 2. Mishima HK, Masuda K, Kitazawa Y, Azuma I: A com...

Ngày tải lên: 11/08/2014, 10:22

... the majority of t hese births in Africa [1]. SCD ori- ginates in tropical regions as a result of its advantage against malaria. It is predominant among people from African, Asian, Arabian and ... MacMillan 1991. 5. De Montalembert M: Management of sickle cell disease. BMJ 2008, 337: a1 397. 6. Bhatia M, Walters MC: Hematopoietic cell transplantation for thalassemia and sickl...

Ngày tải lên: 11/08/2014, 14:21

... this article as: Oliveira Cruz and McPake: Global Health Initiatives and aid effectiveness: insights from a Ugandan case study. Globalization and Health 2011 7:20. Oliveira Cruz and McPake Globalization ... and Health 2011, 7:20 http://www.globalizationandhealth.com/content/7/1/20 Page 9 of 10 RESEA R C H Open Access Global Health Initiatives and ai...

Ngày tải lên: 11/08/2014, 14:21

... mapping of wild introgressions into cultivated peanut: a way toward enlarging the genetic basis of a recent allotetraploid Daniel Foncéka 1 , Tossim Hodo-Abalo 2,3 , Ronan Rivallan 1 , Issa ... result indicates that A. duran- ensis and A. ipaiensis are more closely related to the A and the B genomes of the cultivated species than are A. carde-...

Ngày tải lên: 12/08/2014, 03:21