Báo cáo khoa học: "A flexible radial increment taper equation derived from a process-based carbon partitioning model" pot

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA GCA T) and RGG1 ... primers: KGG3-2 forward d(AAA GGT GGC AAA GGT GGA GAC AGA GGT GGC TT) and KGG3-2 reverse d(GAA CAT TCC ACC GGG ACC ACC AC). pGEX–KGG3-4 was generated by PCR using pGEX–KGG2 as a t...

Ngày tải lên: 15/02/2014, 01:20

11 787 0
Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf

... Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity Lorenza Sisinni 1,2 , Laura Cendron 1,2 , Gabriella Favaro 3 and Giuseppe Zanotti 1,2 1 ... expression, and purification The HP1286 gene was amplified by PCR from H. pylori CCUG17874 genomic DNA using the following primers: forward, 5Â-CACCAAACCTTATACGATTGATAA...

Ngày tải lên: 16/02/2014, 14:20

10 768 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, ... Journal 276 (2009) 59835997 ê 2009 The Authors Journal compilation ê 2009 FEBS Functional characterization of an orphan cupin protein from Burkholderia xenovorans...

Ngày tải lên: 18/02/2014, 06:20

15 624 0
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

... of the amyloid b-peptide. Proc Natl Acad Sci USA 102, 540 3–5 407. 25 Lemkul JA & Bevan DR (2008) A comparative molecu- lar dynamics analysis of the amyloid b-peptide in a lipid bilayer. Arch ... center of mass and are attracted by contact with the polar back- bone, lipid residues 5 0–6 0 make van der Waals con- tacts with the amino acid side chains of A...

Ngày tải lên: 18/02/2014, 08:20

16 475 0
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

... The Authors Journal compilation ª 2009 FEBS 4761 Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area Christian Krintel 1,2 , ... surface area upon PKA phos- phorylation. This gain in hydrophobic surface area presumably accounts for the increase in in vitro activity...

Ngày tải lên: 18/02/2014, 11:20

11 562 0
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx

Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx

... to Ala eliminated activity in binding to a BPA molecule, and individual mutations drastically reduced the activity. Because Ala lacks the character- istic side chains of Glu and Arg, the mutant ... Glu275Ala, cgg for Glu275Arg, gac for Glu275Asp, and ctg for Glu275Leu); 5Â-TCCTTGGTGTCGTATACxxxTCTCTTTCA-3Â (xxx ẳ gcg for Arg316 fi Ala, aag for Arg316 fi Lys, ctg for Arg31...

Ngày tải lên: 18/02/2014, 16:20

12 583 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... Mu ă ller V (2007) An intermediate step in the evolution of ATPases – the F 1 F 0 -ATPase from Aceto- bacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis. FEBS ... Journal 275 (2008) 19992007 ê 2008 The Authors Journal compilation ª 2008 FEBS An intermediate step in the evolution of ATPases – a hybrid...

Ngày tải lên: 18/02/2014, 17:20

9 773 0
Tài liệu Báo cáo khoa học: "ISSUES IN NATURAL LANGUAGE ACCESS TO DATABASES FROM A LOGIC PROGRAMMING PERSPECTIVE" doc

Tài liệu Báo cáo khoa học: "ISSUES IN NATURAL LANGUAGE ACCESS TO DATABASES FROM A LOGIC PROGRAMMING PERSPECTIVE" doc

... ISSUES IN NATURAL LANGUAGE ACCESS TO DATABASES FROM A LOGIC PROGRAMMING PERSPECTIVE David H D Warren Artificial Intelligence Center SRI International, Menlo Park, CA 94025, USA I INTRODUCTION ... permits data to be defined by general rules having the power of a fully general programming language. The logic programming approach therefore allows one to...

Ngày tải lên: 21/02/2014, 20:20

4 446 0
Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf

Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf

... 2007 FEBS 1611 Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression Attila L. Ne ´ meth 1, *, Pe ´ ter ... above-mentioned ATG codon. Isolation and chemical identification of trypsinogen 4 from human brain Different antihuman trypsinogen 4 mA...

Ngày tải lên: 07/03/2014, 10:20

11 469 0
Báo cáo khoa học: "A flexible radial increment taper equation derived from a process-based carbon partitioning model" pot

Báo cáo khoa học: "A flexible radial increment taper equation derived from a process-based carbon partitioning model" pot

... caseof a stable profile; points: case of a declining profile. C. Deleuze and F. HoullierA radial increment taper function Original article A flexible radial increment taper equation derived from a ... used to analyse parameter variability in relation with calendar year, silvicultural treatment and fertility. 5.3.1. Amance site The trees are young and each annual s...

Ngày tải lên: 08/08/2014, 14:20

14 485 0
báo cáo khoa học: "Computing genetic evaluations through application of generalized least squares to an animal model" pot

báo cáo khoa học: "Computing genetic evaluations through application of generalized least squares to an animal model" pot

... for records of animals without progeny, thus the only equations needed were those of parent and ancestor animals. A practical application of this ô reduced animal model ằ to swine ... squares to an animal model G.F.S. HUDSON Department of Animal Sciences, University of Maryland, College Park, Maryland 20742, U.S.A. Summary The animal...

Ngày tải lên: 09/08/2014, 22:22

10 229 0
Báo cáo khoa hoc:" Topical latanoprost causes posterior movement of lens in a patient with exfoliation syndrome and subluxated lens: a case report" ppt

Báo cáo khoa hoc:" Topical latanoprost causes posterior movement of lens in a patient with exfoliation syndrome and subluxated lens: a case report" ppt

... cor- nea and lens will reduce the overall refractive power of the Change in lens position after topical latanoprostFigure 2 Change in lens position after topical latanoprost. Photographs before latanoprost ... ciliary body thickness after topical application of pharmacogic agents. Am J Ophthalmol 1996, 121:319-321. 2. Mishima HK, Masuda K, Kitazawa Y, Azuma I: A com...

Ngày tải lên: 11/08/2014, 10:22

3 242 0
báo cáo khoa học: "Psychosocial impact of sickle cell disorder: perspectives from a Nigerian setting" doc

báo cáo khoa học: "Psychosocial impact of sickle cell disorder: perspectives from a Nigerian setting" doc

... the majority of t hese births in Africa [1]. SCD ori- ginates in tropical regions as a result of its advantage against malaria. It is predominant among people from African, Asian, Arabian and ... MacMillan 1991. 5. De Montalembert M: Management of sickle cell disease. BMJ 2008, 337: a1 397. 6. Bhatia M, Walters MC: Hematopoietic cell transplantation for thalassemia and sickl...

Ngày tải lên: 11/08/2014, 14:21

6 278 0
báo cáo khoa học: " Global Health Initiatives and aid effectiveness: insights from a Ugandan case study" doc

báo cáo khoa học: " Global Health Initiatives and aid effectiveness: insights from a Ugandan case study" doc

... this article as: Oliveira Cruz and McPake: Global Health Initiatives and aid effectiveness: insights from a Ugandan case study. Globalization and Health 2011 7:20. Oliveira Cruz and McPake Globalization ... and Health 2011, 7:20 http://www.globalizationandhealth.com/content/7/1/20 Page 9 of 10 RESEA R C H Open Access Global Health Initiatives and ai...

Ngày tải lên: 11/08/2014, 14:21

10 266 0
báo cáo khoa học: " Genetic mapping of wild introgressions into cultivated peanut: a way toward enlarging the genetic basis of a recent allotetraploid" docx

báo cáo khoa học: " Genetic mapping of wild introgressions into cultivated peanut: a way toward enlarging the genetic basis of a recent allotetraploid" docx

... mapping of wild introgressions into cultivated peanut: a way toward enlarging the genetic basis of a recent allotetraploid Daniel Foncéka 1 , Tossim Hodo-Abalo 2,3 , Ronan Rivallan 1 , Issa ... result indicates that A. duran- ensis and A. ipaiensis are more closely related to the A and the B genomes of the cultivated species than are A. carde-...

Ngày tải lên: 12/08/2014, 03:21

13 425 0
Từ khóa:
w