Báo cáo khoa học: "Needle nutrients in geographically diverse Pinus sylvestris L. populations" docx

... (2006) Lung adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond to a tyrosine kinase inhibitor or to down-regulation of the receptors. Genes Dev 20, 1496–1510. 5 ... Ito F (2009) Mito- gen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor recepto...

Ngày tải lên: 16/02/2014, 09:20

... versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein Ilaria Sambi 1 , Pietro Gatti-Lafranconi 1 *, Sonia Longhi 2 and Marina Lotti 1 1 Dipartimento ... with a forward primer (5Â-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3Â) designed to introduce a hexahistidine tag and a ClaI restrictio...

Ngày tải lên: 18/02/2014, 04:20

... are also interesting with regards to brain vas- culature, because they regulate the formation and main- tenance of BBB, modulate neurovascular coupling and maintain several parts of brain homeostasis. ... origin [78]. According to the monocyte hypothesis, during embryogenesis, and even in adults, migrating monocytes enter the brain via blood vessels and then differenti...

Ngày tải lên: 18/02/2014, 11:20

... VEGF-D, binds and activates this receptor, resulting in the proliferation and migration of lymph ECs and lymphangiogenesis [13]. Angiogenesis in brain diseases Brain stroke Stroke is induced through: ... among tissues in the body, and the risk of edema to brain functions should be carefully considered. Brain edema may increase pressure in the cranial cavity and...

Ngày tải lên: 18/02/2014, 11:20

... MINIREVIEW Brain angiogenesis in developmental and pathological processes: neurovascular injury and angiogenic recovery after stroke Ken Arai, Guang Jin, Deepti Navaratna and Eng H. ... whether neurovascular responses after stroke can be reinter- preted in the context of angiogenesis in the brain. Is it possible that some of the acute neurovascular...

Ngày tải lên: 18/02/2014, 11:20

... activates adenylate cyclase (CyaA) and leads to an increase in the intra- cellular cyclic AMP (cAMP) level [1]. Mathematical models of catabolite repression in E. coli The (isolated) reactions of the ... key players of catabolite repression. Mathematical modelling of signal transduction and gene expres- sion of the enzymes involved in the transport of carbohydrate...

Ngày tải lên: 18/02/2014, 13:20

... Vitellogenin, in the mosquito Aedes aegypti. Mol Cell Endocrinol 267, 97–105. 20 Velarde RA, Robinson GE & Fahrbach SE (2006) Nuclear receptors of the honey bee: annotation and expression in the ... reorganization of the follicular epithelium in the resulting adults [40]. DmE75A and DmE75B have been implicated in defining the transition stages 8 and 9 o...

Ngày tải lên: 18/02/2014, 13:20

... English and a French versions of a software manual contain 628 and 640 paragraphs, respectively. In all, there are 30 para- graphs embedded in them which do not have a trans- lation (some in fact ... Grove, CA., 1991. Morgan Kaufmann. [Gale and Church, 1991b] William A. Gale and Kenneth W. Church. A program for alinging sen- tences in bilingual corpora. In Proceed...

Ngày tải lên: 22/02/2014, 10:20

... conceptual and practical introduction into the principles of wiring or constructing special machines for lan- guage processing tasks instead of programming a universal machine. Construction would in ... $2 Parse information 153 CONCURRENT PARSING IN PROGRAMMABLE LOGIC ARRAY (PLA-) NETS PROBLEMS AND PROPOSALS Helmut Schnelle RUHR-Universit~t Bochum Sp~achwissenscha...

Ngày tải lên: 31/03/2014, 17:20

... 47 o 20’ 16 o 28’ 300 J. Oleksyn et al.Needle nutrients in Pinus sylvestris populations Original article Needle nutrients in geographically diverse Pinus sylvestris L. populations Jacek Oleksyn a,b,* , ... variation in Scots pine (Pinus sylvestris L.) coordinated by IUFRO, Silvae Genet. 41(1992) 133–143. [7] Gracan J., Peric Z., Growth of different Scots pine (Pin...

Ngày tải lên: 08/08/2014, 14:20

... initiation of loblolly pine Original article Somatic embryogenesis in loblolly pine (Pinus taeda L.): improving culture initiation rates Gerald S. Pullman * and Shannon Johnson Institute of Paper Science ... embryogenesis in culture media containing abscisic acid, U.S. Patent 5,856,191, January 5, 1999. [12] Li X.Y., Huang F.H., Induction of somatic embryoge...

Ngày tải lên: 08/08/2014, 14:20

... Original article Mineral nutrients of beech (Fagus sylvatica) bark in relation to frost sensitivity and soil treatments in southern Sweden Anna Maria Jönsson* Dept. of Ecology, Forest ... bark and to evaluate effects of soil amendments and changes in N input. The aim was also to correlate the concentration of nutrients to the appear- a...

Ngày tải lên: 08/08/2014, 14:21

... note- worthy, as the species can be found from the edge of the sea, on the northern side of the Mediterranean, up to an altitude of 2 500-2 600 m in the Atlas Mountains (Barbero ... evaluated indirectly by analyzing the significant floristic complex growing alongside the holm oak. The Valli- guières population is located at the...

Ngày tải lên: 08/08/2014, 19:21

... "In the Eye of the Needle: Diary of a Medically Supervised Injecting Centre" by Ingrid van Beek Allen & Unwin 2004 Allan Clear* Address: Executive Director, Harm Reduction Coalition, ... in that they will be adopted gradually at a glacial pace. I would love to see a spate of books inspired by "In the Eye of the Needle: Di...

Ngày tải lên: 11/08/2014, 20:20

... Japan and 5 Center for Disease Management, Ministry of Health and Medical Education, Iran Email: Mohsen Vazirian - vazirian_mohsen@yahoo.com; Bijan Nassirimanesh - bijan@ahrn.net; Saman Zamani* ... outreach HIV prevention program in Tehran, Iran: A cross-sectional study Mohsen Vazirian 1,2 , Bijan Nassirimanesh 3 , Saman Zamani* 4 , Masako Ono- Kihara 4 , Masahiro Ki...

Ngày tải lên: 11/08/2014, 20:20