... (2006) Lung adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond to a tyrosine kinase inhibitor or to down-regulation of the receptors. Genes Dev 20, 1496–1510. 5 ... Ito F (2009) Mito- gen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor recepto...
Ngày tải lên: 16/02/2014, 09:20
... versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein Ilaria Sambi 1 , Pietro Gatti-Lafranconi 1 *, Sonia Longhi 2 and Marina Lotti 1 1 Dipartimento ... with a forward primer (5Â-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3Â) designed to introduce a hexahistidine tag and a ClaI restrictio...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: regulation, molecular and cellular communication at the neurovascular interface pdf
... are also interesting with regards to brain vas- culature, because they regulate the formation and main- tenance of BBB, modulate neurovascular coupling and maintain several parts of brain homeostasis. ... origin [78]. According to the monocyte hypothesis, during embryogenesis, and even in adults, migrating monocytes enter the brain via blood vessels and then differenti...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: therapeutic aspects of vascular endothelial growth factor doc
... VEGF-D, binds and activates this receptor, resulting in the proliferation and migration of lymph ECs and lymphangiogenesis [13]. Angiogenesis in brain diseases Brain stroke Stroke is induced through: ... among tissues in the body, and the risk of edema to brain functions should be carefully considered. Brain edema may increase pressure in the cranial cavity and...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: neurovascular injury and angiogenic recovery after stroke docx
... MINIREVIEW Brain angiogenesis in developmental and pathological processes: neurovascular injury and angiogenic recovery after stroke Ken Arai, Guang Jin, Deepti Navaratna and Eng H. ... whether neurovascular responses after stroke can be reinter- preted in the context of angiogenesis in the brain. Is it possible that some of the acute neurovascular...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx
... activates adenylate cyclase (CyaA) and leads to an increase in the intra- cellular cyclic AMP (cAMP) level [1]. Mathematical models of catabolite repression in E. coli The (isolated) reactions of the ... key players of catabolite repression. Mathematical modelling of signal transduction and gene expres- sion of the enzymes involved in the transport of carbohydrate...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression profiling ppt
... Vitellogenin, in the mosquito Aedes aegypti. Mol Cell Endocrinol 267, 97–105. 20 Velarde RA, Robinson GE & Fahrbach SE (2006) Nuclear receptors of the honey bee: annotation and expression in the ... reorganization of the follicular epithelium in the resulting adults [40]. DmE75A and DmE75B have been implicated in defining the transition stages 8 and 9 o...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: "Text Alignment in a Tool for Translating Revised Documents" docx
... English and a French versions of a software manual contain 628 and 640 paragraphs, respectively. In all, there are 30 para- graphs embedded in them which do not have a trans- lation (some in fact ... Grove, CA., 1991. Morgan Kaufmann. [Gale and Church, 1991b] William A. Gale and Kenneth W. Church. A program for alinging sen- tences in bilingual corpora. In Proceed...
Ngày tải lên: 22/02/2014, 10:20
Báo cáo khoa học: "CONCURRENT PARSING IN PROGRAMMABLE LOGIC ARRAY PROBLEMS AND PROPOSALS" docx
... conceptual and practical introduction into the principles of wiring or constructing special machines for lan- guage processing tasks instead of programming a universal machine. Construction would in ... $2 Parse information 153 CONCURRENT PARSING IN PROGRAMMABLE LOGIC ARRAY (PLA-) NETS PROBLEMS AND PROPOSALS Helmut Schnelle RUHR-Universit~t Bochum Sp~achwissenscha...
Ngày tải lên: 31/03/2014, 17:20
Báo cáo khoa học: "Needle nutrients in geographically diverse Pinus sylvestris L. populations" docx
... 47 o 20’ 16 o 28’ 300 J. Oleksyn et al.Needle nutrients in Pinus sylvestris populations Original article Needle nutrients in geographically diverse Pinus sylvestris L. populations Jacek Oleksyn a,b,* , ... variation in Scots pine (Pinus sylvestris L.) coordinated by IUFRO, Silvae Genet. 41(1992) 133–143. [7] Gracan J., Peric Z., Growth of different Scots pine (Pin...
Ngày tải lên: 08/08/2014, 14:20
Báo cáo khoa học: "Somatic embryogenesis in loblolly pine (Pinus taeda L.): improving culture initiation rates" potx
... initiation of loblolly pine Original article Somatic embryogenesis in loblolly pine (Pinus taeda L.): improving culture initiation rates Gerald S. Pullman * and Shannon Johnson Institute of Paper Science ... embryogenesis in culture media containing abscisic acid, U.S. Patent 5,856,191, January 5, 1999. [12] Li X.Y., Huang F.H., Induction of somatic embryoge...
Ngày tải lên: 08/08/2014, 14:20
Báo cáo khoa học: "Mineral nutrients of beech (Fagus sylvatica) bark in relation to frost sensitivity and soil treatments in southern Sweden" docx
... Original article Mineral nutrients of beech (Fagus sylvatica) bark in relation to frost sensitivity and soil treatments in southern Sweden Anna Maria Jönsson* Dept. of Ecology, Forest ... bark and to evaluate effects of soil amendments and changes in N input. The aim was also to correlate the concentration of nutrients to the appear- a...
Ngày tải lên: 08/08/2014, 14:21
Báo cáo khoa học: "Proanthocyanic polymorphism in holm oak (Quercus ilex L) in the Mediterranean region of France" pps
... note- worthy, as the species can be found from the edge of the sea, on the northern side of the Mediterranean, up to an altitude of 2 500-2 600 m in the Atlas Mountains (Barbero ... evaluated indirectly by analyzing the significant floristic complex growing alongside the holm oak. The Valli- guières population is located at the...
Ngày tải lên: 08/08/2014, 19:21
báo cáo khoa học: " Review of "In the Eye of the Needle: Diary of a Medically Supervised Injecting Centre" by Ingrid van Beek Allen & Unwin 2004" potx
... "In the Eye of the Needle: Diary of a Medically Supervised Injecting Centre" by Ingrid van Beek Allen & Unwin 2004 Allan Clear* Address: Executive Director, Harm Reduction Coalition, ... in that they will be adopted gradually at a glacial pace. I would love to see a spate of books inspired by "In the Eye of the Needle: Di...
Ngày tải lên: 11/08/2014, 20:20
báo cáo khoa học: " Needle and syringe sharing practices of injecting drug users participating in an outreach HIV prevention program in Tehran, Iran: A cross-sectional study" pps
... Japan and 5 Center for Disease Management, Ministry of Health and Medical Education, Iran Email: Mohsen Vazirian - vazirian_mohsen@yahoo.com; Bijan Nassirimanesh - bijan@ahrn.net; Saman Zamani* ... outreach HIV prevention program in Tehran, Iran: A cross-sectional study Mohsen Vazirian 1,2 , Bijan Nassirimanesh 3 , Saman Zamani* 4 , Masako Ono- Kihara 4 , Masahiro Ki...
Ngày tải lên: 11/08/2014, 20:20