Báo cáo khoa học: "Impact of several common tree species of European temperate forests on soil fertility" pot

... from the salivary gland of Octopus vulgaris oct-TK-I Lys–Pro–Pro–Ser–Ser–Ser–Glu–Phe–Ile–Gly–Leu–Met–NH 2 oct-TK-II Lys–Pro–Pro–Ser–Ser–Ser–Glu–Phe–Val–Gly–Leu–Met–NH 2 Substance P and SP-(Arg11) Substance ... tachykinins: a review. Zool Sci 5, 53 3–5 49. 7 Satake H, Ogasawara M, Kawada T, Masuda K, Aoy- ama M, Minakata H, Chiba T, Metoki H, Satou Y & Satoh N (2004) Tachykini...

Ngày tải lên: 19/02/2014, 00:20

... 2010 The Authors Journal compilation ê 2010 FEBS Flexibility and communication within the structure of the Mycobacterium smegmatis methionyl-tRNA synthetase Henrik Ingvarsson and Torsten Unge Department ... amide groups of Ile128 and Arg129. Despite these differences in the coordination of the res- idues in the tip, the fold of the loop i...

Ngày tải lên: 06/03/2014, 22:21

... TTAGTTACCGTGTGCTTC OMCB- F CTGCTGCTCGCAGCAAGT OMCB- R GTGTGATCTGCAACTGTT OMCA- PBAD-F CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC OMCA- PBAD-R TTAGTTACCGTGTGCTTC OMCB- PBAD-F CACCGAGGAATAATAAATGATG AACGCACAAAAATCA OMCB- PBAD-R ... study. Oligonucleotide name Sequence (5Â -to3 Â) OMCA- KO-F CACACTGCAACCTCTGGT OMCA- KO-R ACTGTCAATAGTGAAGGT OMCB- KO-F CCCCATGTCGCCTTTAGT OMCB- KO-R TCGCTAGAA...

Ngày tải lên: 07/03/2014, 09:20

... the SF1 DNA NTPase/helicases from Escherichia coli and Bacillus stearothermophilus, and of the SF2 HCV RNA NTPase/helicase, have confirmed the functions of these conserved motifs [13–16]. Blockage ... from the amino terminus, was amplified by PCR using the following primers: forward, 5Â-CATGCC ATGGCGCCATTTTTCTTGAGACATGCC-3Â; reverse, 5Â-CTGGGATCCGTCCGAATCAGGTTCCTTC-3Â (purcha...

Ngày tải lên: 08/03/2014, 02:20

... cases and 800 000 deaths occur annually, making measles the most important cause of infant mortality worldwide. The low vaccine coverage and the low vaccine efficacy in the presence of maternal antibodies ... Biochem. 270) 1523 Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein...

Ngày tải lên: 08/03/2014, 08:20

... purification, character- ization and structural analysis of charybdin, a novel 29-kDa type 1 ribosome-inactivating protein, from bulbs of the white variety of C. maritima agg. Results Charybdin was ... crystallography. Acta Crystallogr D Biol Crystallogr 50, 760–763. 22 Navaza J (19 94) AmoRe: an automated package for molecular replacement. Acta Crystallogr A 50, 15...

Ngày tải lên: 16/03/2014, 14:20

... FEBS 2003 nNOS inhibition, antimicrobial and anticancer activity of the amphibian skin peptide, citropin 1.1 and synthetic modifications The solution structure of a modified citropin 1.1 Jason ... residues. These include lesueurin [17], dahleins 1.1 and 1.2 [53] and some synthetic modifications of lesueurin. The solution structure of citr...

Ngày tải lên: 17/03/2014, 09:20

... squamous cell carcinoma and five human melanomas. Thus, these data clarify in detail the cutaneous expression of the P450scc system; they also amplify and extend recent information on an active P450scc ... 353 4184 A. Slominski et al.(Eur. J. Biochem. 271) Ó FEBS 2004 A novel pathway for sequential transformation of 7-dehydrocholesterol and expression...

Ngày tải lên: 23/03/2014, 13:20

... MINIREVIEW Thiamin diphosphate in biological chemistry: analogues of thiamin diphosphate in studies of enzymes and riboswitches Kwasi Agyei-Owusu and Finian J. Leeper Department of Chemistry, ... understanding of ThDP-dependent enzymes, as well as studies of thiamin analogues as drug molecules and in the field of riboswitches. Modifications t...

Ngày tải lên: 29/03/2014, 23:20

... permea- bilization of the mitochondrial membrane are involved in mitochondrial damage. Our data demonstrate that hypoxia ⁄ reoxygenation and extramitochondrial Ca 2+ cause functional damage of isolated rat liver ... From these data we conclude that extramitochondrial Ca 2+ at a narrow concentration window exerts a protective effect upon hypoxia ⁄ reoxygenation by increa...

Ngày tải lên: 30/03/2014, 11:20

... complex Xuhong Zhang 1 , Catharina T. Migita 2 , Michihiko Sato 3 , Masanao Sasahara 1 and Tadashi Yoshida 1 1 Department of Biochemistry, Yamagata University School of Medicine, Japan 2 Department of Biological ... essentially similar to those of mammalian HOs. Prokaryotic plant heme oxygenase activity was first found in a red alga, Cyanidium caldarium, and then in cyanobacteria...

Ngày tải lên: 30/03/2014, 15:20

... [217; 2 stands]. ²L. Augusto et al.Impact of tree species on soil fertility Review Impact of several common tree species of European temperate forests on soil fertility Laurent Augusto a , Jacques ... CONSEQUENCES ON SOIL FERTILITY 7.1. Localisation and intensity of soil modifications On the time scale of a few decades, the impact of the species...

Ngày tải lên: 08/08/2014, 14:20

... bioelement supplies to the soil by the litter of these species and by throughfall with a view to defining their role in the soil and, more gen- erally, in ecosystem bioelement ... J.F., Martin A., Santa Regina I., Nutri- ent cycling in deciduous forest ecosystems of the Sierra de Gata mountains: aboveground litter produ...

Ngày tải lên: 08/08/2014, 14:21

... 25:8-11. 14. White BE, Kaplan A, Lopez-Terrada DH, Ro JY, Benjamin RS, Ayala AG: Monophasic Synovial Sarcoma Arising in the Vulva. A Case Report and Review of the Literature. Arch Pathol Lab Med 2008, 132:698-702. 15. ... Kawaguchi S, Wada T, Ida K, Sato Y, Nagoya S, Tsukahara T, Kimura S, Sahara H, Ikeda H, Shimozawa K, Asanuma H, Torigoe T, Hiraga H, Ishii T, Tatezaki S...

Ngày tải lên: 09/08/2014, 03:23

... an average, 6 typi- cal chloroplasts were analyzed from each sample of the 3 replicate plots. Results and Discussion At all studied levels of the canopy, the ratio of the ... Comparison between the structure and function of chloroplasts at different levels of willow canopy during a growing season E. Vapaavuori 1 A. Nurmi...

Ngày tải lên: 09/08/2014, 03:24