Báo cáo khoa học: "Circadian variations in salivary chromogranin a concentrations during a 24-hour period in dogs" pps

... concentrations during a 24-hour period in dogs. Horm Metab Res 2003, 35, 355-357. 12. Nakane H, Asami O, Yamada Y, Harada T, Matsui N, Kanno T, Yanaihara N. Salivary chromogranin A as an index ... of salivary CgA concentrations in male and female dogs (mean ± SD). were measured using a Human CgA enzyme-linked immunosorbent assay kit (Yanaihara Institute, Japan)....

Ngày tải lên: 07/08/2014, 23:22

...

Ngày tải lên: 07/08/2014, 18:21

... time that HMG-CoA reductase inhibition by lovastatin sti- mulates caspase activity in rat brain neuroblasts, which may help explain its apoptotic effect. In a parallel way, our data showed that lovastatin ... [28], MAPK kinase kinase 1 (MEKK-1) [29], MAPK kinase kinase kinase (Raf-1), protein kinase B (Akt) [30,31] and pro- tein kinase C (PKC) [32]. PKC is a family of ser- ine ⁄ threo...

Ngày tải lên: 23/03/2014, 11:20

... communicated by the switchboard operators through the hospital loudspeakers and paging system, and a detailed log of all calls is maintained. Criteria for medical emergency team activation Calling ... this to aspects of nursing and medical daily routine. Materials and methods The hospital Austin Health is a university-affiliated teaching hospital with three hospital campuses situated in...

Ngày tải lên: 25/10/2012, 10:45

... CAGCAGGATCCTCTAGAGAGTTTAGTCTT TG-3¢)anda5¢-terminus primer (one of 5¢-AAGCT TCACCATGTACCCTGCCCACATGTACCAAGTG TAC-3¢,5¢-AAGCTTCACCATGCCGCACCGG CTC ATCGAGAAAAAGAG-3¢,5¢-AAGCTTCACCATG GCAGTGGTTCTTGAACTTACCTTGAAGC-3¢ or 5¢-AAGCTTCACCATGATTGCCCTGCAGAGTGG TTTACAAGCTG-3¢) ... primers (5¢-CGGCAATTTGTAGGTCTCCTTGCTGTCCTCGC TC-3¢ and 5¢- GCCCGGCTCATCGAGAAAAAGAGA CGTGACCGG-3¢ for DEC1-H5 7A; 5¢-GATGAGCCG...

Ngày tải lên: 19/02/2014, 16:20

... loosen intercellular epithelial junctions at locally restricted areas before a limited number of bacteria gain access to integrins and inject CagA. The basal injection model of CagA can also explain ... several adhesins such as BabA, BabB, SabA, AlpA and AlpB, as well as OipA, which mediate apical binding of the bacteria (1). Attached H. pylori or those in the mucus secrete virulence fact...

Ngày tải lên: 14/02/2014, 19:20

... production, thus driving autoimmune skin in ammation [102]. Patients with rosacea have abnormal in ammation and vascular reactivity in facial skin. These individuals have high levels of cathelicidin and higher ... antibacterial properties of cultured com- posite keratinocyte grafts. Ann Surg 235, 113–124. 37 Midorikawa K, Ouhara K, Komatsuzawa H, Kawai T, Yamada S, Fujiwara T, Yamazaki K,...

Ngày tải lên: 18/02/2014, 06:20

... micelle–water interface was derived from selective line broadening of amide resonances in 1 H- 15 N-HSQC spectra caused by paramagnetic relaxation agents 16-doxylstearic acid and Mn 2+ . The paramagnetic ... micelle-associated VpUcyt was cal- culated on the basis of the final set of proton–proton dis- tance constraints using cyana, a software program that combines simulated annealing with...

Ngày tải lên: 18/02/2014, 06:20

... 5¢-GAT CCTCGCAGGGACTACA-3¢, and AP- 2a- rev, 5¢-GTTGG ACTTGGACAGGGAC-3¢ (annealing temperature 60 °C); Sox9-for, 5¢-CGAACGCACATCAAGACGA-3¢, and Sox9- rev, 5 ¢-AGGTGAAGGTGGAGTAGAGGC-3¢ (annealing temperature 58 °C); integrin ... integrin alpha10-for, 5¢-CATGAGGTT CACCGCATCACT-3¢, and integrin alpha10-rev, 5¢-AAGG CAAAGGTCACAGTCAAGG-3¢ (annealing temperature 64 °C). The expression ratios of the...

Ngày tải lên: 18/02/2014, 08:20

... TCC ATC GAC TAC TCC CTG-3¢, the antisense primer 5¢-AAG AAT TCT AGA TTA ATG GTG ATG ATG GTG ATG ATG GTG TGG GGT CAG CGG TGC AGC AGG GGG GGT-3¢ (XbaI sites underlined; His-tag in italic) and pVL1393–HSL ... released fatty acids in the upper phase was determined by scintillation counting. For all assays, we confirmed that the reaction velocity was constant during the 30 min incubation per...

Ngày tải lên: 18/02/2014, 11:20