Báo cáo toán học: "Products of all elements in a loop and a framework for non-associative analogues of the Hall-Paige conjecture" potx

... below). For information about publishing your research in Journal of Inequalities and Applications go to http://www.journalofinequalitiesandapplications.com/authors/instructions/ For information about ... has a random fixed point are obtained. By introducing a random iteration process with weak contraction random operator, we obtain a convergence theorem of the random itera...

Ngày tải lên: 20/06/2014, 21:20

... it is therefore disjoint from Q ′ . 7 Theorem 2.4 An A- loop is a loop in which all inner mappings are automorphisms. The variety of A- loops is larger than that of groups but is certainly not all loops. ... number of related results including a generalization of the D´enes-Hermann theorem and provide an elementary proof of a weak form o f the Hall-Paige...

Ngày tải lên: 07/08/2014, 21:21

... where the product is over all barred a ∈ T , i (a) is the index of the particular Young diagram in which a resides, and c (a) and r (a) denote the column and row numbers of a in this Young diagram. 5 4 5 3 3 4 5 1 1 ... 4.1(ii) and (iii). All proofs in this section are replicas or modifications of proofs appearing in Macdonald [Ma3, Chapter 1]. We point...

Ngày tải lên: 07/08/2014, 21:20

... training data) 1 . Reranking Candidate 1 Candidate 2 Candidate 3 Candidate 4 : Case element : Verb Candidate Candidate Figure 2: Selection of possible parses for reranking Many methods for reranking the parsing of ... improving the parsing accuracy. We can also verify that the parsing accuracy improves by using imprecise information obtained from an automati- cally parsed corpus...

Ngày tải lên: 20/02/2014, 12:20

... graph G is contained in a circuit of length at most 3 or 4, then G admits a 3-NZF. Theorem 1.5 and the following early results are partial results of the open problem above. Theorem 1.8 (Catlin ... and e = xy ∈ E(G) .The graph G ∗e is obtained from G by deleting the edge e and adding two new vertices x  and y  and adding two new edges, e x and e y , joining x a...

Ngày tải lên: 07/08/2014, 07:21

... conjecture as well our proof of Ba- pat’s conjecture are based on the Alexandrov inequalities for mixed discriminants [1] and some optimization theory, which is rather advanced in the case of the Bapat’s ... conjecture. They all rely heavily on the matrix structure and essentially of non-inductive nature. (D. I. Falikman independently rediscovered in [5] the diagon...

Ngày tải lên: 07/08/2014, 15:23

... character- ized by means of MALDI-MS [38,39] performed in a Finnigan MAT mass spectrometer 8230 (Midland; Canada). In a control assay, the reaction was performed in the absence of silicatein. Esterase ... molecules in an organized, fractal manner [33,34]; the fractal pat- tern probably dictates the initial shape of the spicules [34]. The finding that silicatein ca...

Ngày tải lên: 18/02/2014, 16:20

... 5¢-CCGTT TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢. C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢. ... 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢. D21 6A: 5¢-G CGAGCTTATATCTTTTGCAATGAAGATAAATCAT TTCCAGTTGAG-3¢ All of the primers were 5¢-phosphorylated...

Ngày tải lên: 24/03/2014, 04:21

... and p105Rb, leading to transfor- mation and carcinogenesis [2], facilitate cell immortalisa- tion in primary human keratinocytes [3], increase genomic instability [4], and maintain the transformed phenotype ... CTL assays. All the animals were housed and handled in accordance with the European guidelines no. 86/609/CEE and 116/92 for the protection of laboratory ex...

Ngày tải lên: 18/06/2014, 16:20

... can obtain the the probability of each state and the concurrence. As shown in Figure 2, with the decrease of P 2 (t) and P 3 (t), the probability of the two SQDs in the state |1 increases. At ... Owing to the advantages of the solid-state of SQDs and integrated circuits of these nanostructures, the complex system is a promising candidate to implement...

Ngày tải lên: 20/06/2014, 20:20