... transcripts are found in the organizer of gastrula embryos, later in the prechordal plate and axial mesoderm (Fig. 2). By contrast, noggin2 tran- scripts are detected at the end of gastrulation in the axial ... other members of the TGF-b family, binding to and inhibit- ing these signaling molecules from binding to their receptors in the extracellular space, thus inhi...
Ngày tải lên: 19/02/2014, 00:20
... incubation with a rabbit serum raised against HNE–protein adducts. Ligand- binding tests showing the functionality of the same HNE-treated porcine (B) and bovine (C) OBPs as in the immunostaining. ... was finally calculated by sub- tracting the values determined in the ultrafiltrates from the initial amounts of HNE. The second aliquot of each sample that had been store...
Ngày tải lên: 23/03/2014, 10:20
Báo cáo khoa học: "Malignant ocular melanoma in a dog" pptx
...
Ngày tải lên: 07/08/2014, 18:21
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a GSP-...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf
... expression in female hearts indicates that myocardial glucose metabolism may be increased in parallel. As optimization of glucose metabolism is increasingly highlighted as a therapeutic intervention for ... effects via the prosurvival serine-threonine protein kinase, Akt (also known as protein kinase B) [2]. In agreement with this, elevated levels of activated Akt in female he...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx
... how osmosensing and osmosignaling integrate into the overall context of growth factor signaling and the execution of apoptotic programs. Abbreviations EGF, epidermal growth factor; MAPK, mitogen-activated ... hydration as the primary factor in carcinogenesis: a unifying concept. Med Hypotheses 66, 518–526. 25 Maeno E, IshizakiY, Kanaseki T, Hazama A & OkadaY (2000) Normoto...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf
... (glutamate or aspartate) in transmembrane helix four as part of the ion-binding site. Therefore, the c ring of A. woodii has only 10 membrane-buried negative charges that are essential for binding ... binding the ion and also for the rotational mechanism of the ring. The c ring of I. tartaricus has 11 negative charges that are equally distributed along the horizontal...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx
... Osanai K, Takahashi K, Nakamura K, Takahashi M, Ishigaki M, Sakuma T, Toga H, Suzuki T & Voelker DR (2005) Expression and characterization of Rab38, a new member of the Rab small G protein ... with the yeast mitochondrial outer mem- brane in yeast is integral in the membrane and most of the integral outer membrane proteins behave as if they have a- helical transmembra...
Ngày tải lên: 19/02/2014, 07:20
Tài liệu Báo cáo khoa học: "Automatic error detection in the Japanese learners’ English spoken data" pdf
... ,, ∑ ∑ ∑ ∈∈ ∈∈∈∈ −= ≤≤∀ = BbAa j BbAaBbAa jj bapbappH kjffor bagbapbagbap We assumed that the constraint of feature sets f i (i ≦ j ≦ k) was defined by Eq. 1. This is where A is a set of categories and B is a set of ... “Standard Speaking Test (SST)”. The SST is a face-to-face interview between an examiner and the test-taker. In most cases, the examiner is a...
Ngày tải lên: 20/02/2014, 16:20
Tài liệu Báo cáo khoa học: "Reactive Content Selection in the Generation of Real-time Soccer Commentary" pdf
... manually annotated each statement in the Japanese output for the RoboCup'9? quater-final with it optimal time for utterance. We then calculated the average delay in the appearance of these ... that intuitively capture the amount of information communicated to the audience. We describe how a principle of maximizing the total gain of importance scores during...
Ngày tải lên: 20/02/2014, 18:20