Báo cáo khoa học: " Protection of chickens from Newcastle disease with a recombinant baculovirus subunit vaccine expressing the fusion and hemagglutinin- neuraminidase proteins" pdf

Báo cáo khoa học: Protection of chylomicron remnants from oxidation by incorporation of probucol into the particles enhances their uptake by human macrophages and increases lipid accumulation in the cells ppt

Báo cáo khoa học: Protection of chylomicron remnants from oxidation by incorporation of probucol into the particles enhances their uptake by human macrophages and increases lipid accumulation in the cells ppt

... demonstrate that antioxidants carried in chylomicron remnants enhance lipid accumulation in macrophages, and that this is caused by a markedly increased rate of uptake of the particles and by a raised ... (CHAOS). Lancet 347, 781–786. 11. Clarke, R. & Armitage, J. (2002) Antioxidant vitamins and risk of cardiovascular disease. Review of large scale randomised trials....

Ngày tải lên: 16/03/2014, 16:20

11 291 0
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc

Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc

... Oliveira FW, Chavante SF, Santos EA, Dietrich CP & Nader HB (1994) Appearance and fate of a beta- galactanase, alpha, beta-galactosidases, heparan sulfate and chondroitin sulfate degrading ... material for the study of intact CS chains. Hexasaccharides Although data from disaccharides, trisaccharides and tetrasaccharides are valuable for the detailed structural character...

Ngày tải lên: 16/03/2014, 14:20

11 481 0
Báo cáo khoa học: Abundance of intrinsic disorder in SV-IV, a multifunctional androgen-dependent protein secreted from rat seminal vesicle pot

Báo cáo khoa học: Abundance of intrinsic disorder in SV-IV, a multifunctional androgen-dependent protein secreted from rat seminal vesicle pot

... sepa- ration between sets of natively unfolded and ideally globular proteins. Following the same rationale as above, we compared the mean value of the artificial parameter for SV-IV and the two ... methods Protein databases The database of disordered proteins was created using a list of natively unfolded proteins [39] and the SWISS-PROT protein sequence data bank [6...

Ngày tải lên: 23/03/2014, 07:20

12 337 0
Báo cáo khoa học: Regulation of output from the plant circadian clock pot

Báo cáo khoa học: Regulation of output from the plant circadian clock pot

... 11819–11820. 76 Takai N, Nakajima M, Oyama T, Kito R, Sugita C, Sugita M, Kondo T & Iwasaki H (2006) A KaiC-asso- ciating SasA–RpaA two-component regulatory system as a major circadian timing mediator ... (Betula pubescens), Lap- land diapensia (Diapensia lapponica) and leatherleaf (Chamaedaphne calyculata), germination is controlled by day-length [25–28]. The existence of photo...

Ngày tải lên: 23/03/2014, 10:20

11 303 0
Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf

Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf

... semantic analysis, and pragmatic analysis. Each stage has been designed to use linguistic data such as the lexicon and grammar, which are maintained separately from the engine, and can easily ... into our natural language understanding system. Client- server architecture was used to make a large volume of lexical information and a large knowledge base available to...

Ngày tải lên: 20/02/2014, 18:20

5 417 0
Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx

Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx

... K, Kagawa W, Takata M, Takeda S, Yokoyama S & Shibata T (2001) Homologous-pairing activity of the human DNA-repair proteins Xrcc3.Rad51C. Proc Natl Acad Sci USA 98, 5538–5543. 20 Kagawa W, ... compilation ª 2010 FEBS Experimental procedures DNA A 74-mer ssDNA (5¢-ACGGGTGGGGTGGACATTGAC GAAGGCTTGGAAGACTTTCCGCCGGAGGAGGAGT TGCCGTTTTAATAAGGATC-3¢) (Hokkaido System Science, Hokkaido, Japa...

Ngày tải lên: 06/03/2014, 09:22

13 447 0
Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot

Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot

... h of incubation in the presence of SsCSC and PfCGC, the enzymatic activity of SsMTAPII and its mutant, expressed as a percentage of their control enzymes, reaches 86.8% and 51.8%, and 68% and ... in the presence of various oxidative folding catalysts (reactiva- tion assay). The catalytic activity of (A) SsM- TAPII and SsMTAPIIC259S ⁄ C261S and (B) PfPNP an...

Ngày tải lên: 07/03/2014, 00:20

7 496 0
Báo cáo khoa học: Reaction of human UMP-CMP kinase with natural and analog substrates docx

Báo cáo khoa học: Reaction of human UMP-CMP kinase with natural and analog substrates docx

... or L -3TCDP. Results Analysis of the forward reaction catalysed by UMP-CMP kinase with natural substrates and nucleoside analogs The purified recombinant human UMP-CMP kinase expressed as a His-tag fusion was analyzed ... Figure 1A and Table 1 show the activity of human UMP-CMP kinase as a function of natural substrates, and the corresponding kinetic param- eters...

Ngày tải lên: 08/03/2014, 02:20

7 384 0
Báo cáo khoa học: Evaluation of potential regulatory elements identi®ed as DNase I hypersensitive sites in the CFTR gene doc

Báo cáo khoa học: Evaluation of potential regulatory elements identi®ed as DNase I hypersensitive sites in the CFTR gene doc

... prominent in Capan1 pancreatic adenocarcinoma cells. Southern blots of DNase I digested (A) Capan1 and (B) Caco2 chromatin cleaved with BamHI and hybridized with the F34L prob e. In each panel, lanes ... cotransfection with pCMV/b. Each bar is the average of at least four transfection experiments, with each sample assa yed in triplicate, and standard errors of t he me...

Ngày tải lên: 08/03/2014, 10:20

7 568 0
Báo cáo khoa học: Regulation of DNp63a by tumor necrosis factor-a in epithelial homeostasis docx

Báo cáo khoa học: Regulation of DNp63a by tumor necrosis factor-a in epithelial homeostasis docx

... 5¢-TGACATGTTTTCTGACGGCAA C-3¢; Bax reverse, 5¢-GGAGGCTTGAGGAGTCTCACC-3¢; DNp6 3a forward, 5¢-GGAAAACAATGCCCAGACTC-3¢; DNp6 3a reverse, 5¢-GTGGAATACGTCCAGGTGGC-3¢; GAPDH forward, 5¢-GAAGGTGAAGGTCGGAGTC-3¢; GAPDH ... 5¢-AGGAGTCCGCA TCTCCGTCAGTG-3¢; Noxa forward, 5¢-GAGATGCCTG GGAAGAAGG-3¢; Noxa reverse, 5¢-ACGTGCACCTCCT GAGAAAA-3¢; p21 forward, 5¢-AAGACCATGTGGAC CTGT-3¢; p21 reverse, 5¢-GGTAG...

Ngày tải lên: 16/03/2014, 06:20

12 452 0
w