Báo cáo khoa học: " Prevalence of feline herpesvirus 1, feline calicivirus and Chlamydophila felis in clinically normal cats at a Korean animal shelter" ppt

Báo cáo khoa học: " Prevalence of feline herpesvirus 1, feline calicivirus and Chlamydophila felis in clinically normal cats at a Korean animal shelter" ppt

Báo cáo khoa học: " Prevalence of feline herpesvirus 1, feline calicivirus and Chlamydophila felis in clinically normal cats at a Korean animal shelter" ppt

... FHV -1, those cats in a shelter or a breeding cattery had a low detection rate of C. felis. These results indicate that the Prevalence of FHV -1, FCV and C. felis in an animal shelter 209 clinical ... C, Harbour DA, Graat EA. Factors associated with upper respiratory tract disease caused by feline herpesvirus, feline calicivirus, Chlamydophila felis an...
Ngày tải lên : 07/08/2014, 20:23
  • 3
  • 476
  • 0
Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"

Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"

... acquisition, analysis of the data, statistical analysis and drafting of the manuscript. BC was responsible for data acquisition, analysis of the data, and drafting of the manuscript. JD was responsible ... chronic health evaluation score at day 0. SOFA is the sepsis-related organ failure assessment score at screening day. Renal failure is creatinine clearance <50 ml/minute...
Ngày tải lên : 25/10/2012, 10:39
  • 9
  • 738
  • 1
Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"

Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"

... years (p<0.0 01, OR=3.9). Interestingly, there was a statistically signif- icant association between OAB and hepatitis (p=0.03, OR=2.2). See Table 3. Table 2. Prevalence of OAB, LUTS and ... 2010.11.12 Abstract Purpose: We assess the prevalence of overactive bladder (OAB) a n d i t s r i s k f actors i n a m a l e urologic veterans population. Materials and M...
Ngày tải lên : 25/10/2012, 11:35
  • 4
  • 520
  • 0
Tài liệu Báo cáo khoa học: Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruzi epimastigotes docx

Tài liệu Báo cáo khoa học: Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruzi epimastigotes docx

... results indicate that agmatine cannot fulfill the physiological roles of polyamines, and at the same time strongly suggest that T. cruzi does not contain agmatinase activity that would convert agmatine ... forward and reverse primers pNeo 1 (5¢- CCGGAATTCTGAATGAACTGCAGGACGAGGCAG-3¢) and pNeo 2 (5¢-CCGGAATTCCGGCCATTTTCCACCAT GATATTC-3¢), respectively. The labelled probe specific for rR...
Ngày tải lên : 19/02/2014, 07:20
  • 10
  • 570
  • 0
Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx

Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx

... Manb1fi2Mana1fi2Mana1fi 2Mana1fi2Man and Manb1fi2Manb1fi2Mana1fi 2Mana1fi2Mana1fi2Man were obtained from the man- nan of C. albicans J-1012 (serotype A) [16]. Preparation of mannan Yeast cells were grown at ... Shibata, N., Onozawa, M., Tadano, N., Hinosawa, Y., Suzuki, A. , Ikuta, K., Kobayashi, H., Suzuki, S. & Okawa, Y. (1996) Struc- ture and antigenicity of the mannans of Candi...
Ngày tải lên : 17/03/2014, 03:20
  • 11
  • 456
  • 0
Báo cáo khoa học: Assimilation of excess ammonium into amino acids and nitrogen translocation in Arabidopsis thaliana – roles of glutamate synthases and carbamoylphosphate synthetase in leaves ppt

Báo cáo khoa học: Assimilation of excess ammonium into amino acids and nitrogen translocation in Arabidopsis thaliana – roles of glutamate synthases and carbamoylphosphate synthetase in leaves ppt

... TCAAAGAAGTCCTGAAGAGCGG Gln11 (At5 g37600) F: CCTCTCAGACTCCACTGACAAA R: TTCACTGTCTTCACCAGGAGC Gln12 (At1 g66200) F: TCTCAGACAACAGTGAAAAGATCA R: TGTCTTGACCAGGAGCTTGAC Gln13 (At3 g17820) F: GCCACCGGGAAAATCATC R: ... AATCGAAAACCCTTTCTTAA GLT (At5 g53460) F: TTGGACCTGAGCCAACACTTG R: CATCATCCGTTTTGGTGAGGA carA (At3 g27740) F: TGGTCAGGTGGAGATCAGTGC R: GAGGCTTCAGGGTGGTACTGG carB (At1 g29900) F: AGGAA...
Ngày tải lên : 30/03/2014, 01:20
  • 16
  • 384
  • 0
Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc

Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc

... expression of various alternative reading frame proteins (ARFPs), also named Core+1 proteins, resulting from mechanisms such as ribosomal frame shifting and internal initiation at alternative AUG or ... Natick, MA, USA) at a flow rate of 5 lLÆmin )1 . Calibration was achieved in the positive ion mode, using denaturated horse heart myoglobin (Sigma). Human sera and ELISA Micropl...
Ngày tải lên : 15/03/2014, 09:20
  • 16
  • 498
  • 0

Xem thêm