... Lyashkov A, Sirenko S, Zhu W, Ruknudin A & Maltsev VA (2006) The integra- tion of spontaneous intracellular Ca2+ cycling and surface membrane ion channel activation entrains normal automaticity in ... Physiology and Pharmacology, University of Calgary, Alberta, Canada 2 School of Biomedical Sciences, University of Newcastle, Callaghan, NSW, Australia Long-range signaling Bi...
Ngày tải lên: 16/02/2014, 09:20
... The Authors Journal compilation ª 2009 FEBS 4761 Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area Christian Krintel 1,2 , ... surface area upon PKA phos- phorylation. This gain in hydrophobic surface area presumably accounts for the increase in in vitro activity...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... Journal 273 (2006) 47424753 ê 2006 The Authors Journal compilation ê 2006 FEBS Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human ... below. Competitive binding of CBC and Cbl, calculation of k + We have tested the application of the fluorescent ana- logue CBC as a...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc
... HsRad51 to examine whether these loops are actually involved in DNA binding. Because aromatic residues are involved in the ssDNA binding by bacterial single stranded DNA- binding protein (SSB) and ... to the Rad51- Y232W mutant, the Rad51- D231W, Rad51- S233W, and Rad51- G236W mutants did not cause significant defects in ssDNA binding and dsDNA binding A B...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx
... with the expression of ALR1-ALR1 Fig. 5. Interactions of Alr1p and Alr2p in the split-ubiquitin system. Alr1p and Alr2p were analyzed using the split-ubiquitin system. Cells expressing NubG and ... protein–protein interaction Using the split-ubiquitin system, we investigated the interaction of the C-terminally truncated Alr1 isomers Alr-c36, Alr-c63 and Alr...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: "Types of Common-Sense Knowledge Needed for Recognizing Textual Entailment" ppt
... reads our proofs from start to finish, the flow of the argument indicates which of these forms is intended, but for annotators quickly read- ing through the proofs, the two kinds of knowledge can ... our set of categories. Further surveys would be required to validate this idea. The 20 categories of knowledge covered 215 (97%) of the 221 statements of world knowledge in ou...
Ngày tải lên: 20/02/2014, 05:20
Tài liệu Báo cáo khoa học: Dissociation of DNA polymerase a-primase complex during meiosis in Coprinus cinereus pptx
... step of C. cinereus DNA polymerase a. One unit (1 U) of DNA polymerase was defined as the amount needs to catalyze the incorporation of 1 pmol of [ 3 H]-d TTP into a DNA polymer in 30 min. Protein ... phase stages, in the basidiomycetes, Coprinus cinereus. To study DNA poly- merase a during meiosis, we cloned cDNAs for the C. cinereus DNA polymerase a cata...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khoa học: Structure of the atrial natriuretic peptide receptor extracellular domain in the unbound and hormone-bound states by single-particle electron microscopy ppt
... FEBS Structure of the atrial natriuretic peptide receptor extracellular domain in the unbound and hormone-bound states by single-particle electron microscopy Haruo Ogawa 1 , Yue Qiu 1 , Liming ... single-transmembrane polypeptide, each containing an extracellular ANP- binding domain (ECD), a transmembrane domain, and an intracellular domain cons...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Improvement of ecdysone receptor gene switch for applications in plants: Locusta migratoria retinoid X receptor (LmRXR) mutagenesis and optimization of translation start site pptx
... 4649 Improvement of ecdysone receptor gene switch for applications in plants: Locusta migratoria retinoid X receptor (LmRXR) mutagenesis and optimization of translation start site Ajay K. Singh 1,2 , ... DBD, DNA-binding domain; EcR, ecdysone receptor; FMV, figwort mosaic virus; HsRXR, Homo sapiens retinoid X receptor; LBD, ligand-bindin...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA 22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 ... CCCGCTCGAGTCTTAGAATTATTGAGAACG 3 GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 AAAAGTCGACGAGCTCGTTTTCGACACTGG 7 TTTTGTCGACATGGCGCAACA...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Optimization of D-amino acid oxidase for low substrate concentrations – towards a cancer enzyme therapy pdf
... Optimization of D-amino acid oxidase for low substrate concentrations – towards a cancer enzyme therapy Elena Rosini, Loredano Pollegioni, Sandro Ghisla, Roberto Orru* and Gianluca Molla Dipartimento ... (see Experimental procedures). The data are reported as the average of at least three separate determinations, and the error bars indicate the standard devia...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: Characterization of the glutamyl endopeptidase from Staphylococcus aureus expressed in Escherichia coli pptx
... nonheated samples, the mature form of GluV8 could be renatured even after exposure to heat in the presence of SDS. Role of N-terminal Val69 in processing of the GluV8 proform Finally, the role of N-terminal ... postulated in the experiment of Fig. 2. Mutation of the essential amino acid Ser237 Establishment of the E. coli expression system of GluV8 enab...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Characterization of Mycobacterium tuberculosis nicotinamidase/pyrazinamidase ppt
... deviation of triplicate tests. H. Zhang et al. Characterization of Mycobacterium tuberculosis PncA FEBS Journal 275 (2008) 753–762 ª 2008 The Authors Journal compilation ª 2008 FEBS 757 result of His-tag ... over- expression of M. tuberculosis PncA. Construction of pncA overexpression vector The pncA gene was amplified by PCR from the genomic DNA of M. tuberculosis H37Rv...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: "Tactics of Mycobacterium avium subsp. paratuberculosis for intracellular survival in mononuclear phagocytes" pot
... containing specific antibodies against M. paratuberculosis, increased the uptake of bacilli by bovine mononuclear phagocytes. However, intracellular survival of M. paratuberculosis in the bovine ... Effects of gamma interferon, in- terleukin-10, and transforming growth factor beta on the survival of Mycobacterium avium subsp. paratuberculosis in monocyte-der...
Ngày tải lên: 07/08/2014, 20:23
Báo cáo khoa học: " Comparison of T2 and FLAIR imaging for target delineation in high grade gliomas" pptx
... high- grade gliomas. Int J Radiat Oncol Biol Phys 2001, 50:915-928. doi:10.1186/1748-717X-5-5 Cite this article as: Stall et al.: Comparison of T2 and FLAIR imaging for target delineation in high ... 5:5 http://www.ro-journal.com/content/5/1/5 Page 4 of 7 RESEARC H Open Access Comparison of T2 and FLAIR imaging for target delineation in high...
Ngày tải lên: 09/08/2014, 10:20