Báo cáo khoa học: "Echocardiographic indices in normal German shepherd dogs" pps

... (2006) Lung adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond to a tyrosine kinase inhibitor or to down-regulation of the receptors. Genes Dev 20, 1496–1510. 5 ... Ito F (2009) Mito- gen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor recepto...

Ngày tải lên: 16/02/2014, 09:20

... versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein Ilaria Sambi 1 , Pietro Gatti-Lafranconi 1 *, Sonia Longhi 2 and Marina Lotti 1 1 Dipartimento ... with a forward primer (5Â-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3Â) designed to introduce a hexahistidine tag and a ClaI restrictio...

Ngày tải lên: 18/02/2014, 04:20

... are also interesting with regards to brain vas- culature, because they regulate the formation and main- tenance of BBB, modulate neurovascular coupling and maintain several parts of brain homeostasis. ... origin [78]. According to the monocyte hypothesis, during embryogenesis, and even in adults, migrating monocytes enter the brain via blood vessels and then differenti...

Ngày tải lên: 18/02/2014, 11:20

... VEGF-D, binds and activates this receptor, resulting in the proliferation and migration of lymph ECs and lymphangiogenesis [13]. Angiogenesis in brain diseases Brain stroke Stroke is induced through: ... among tissues in the body, and the risk of edema to brain functions should be carefully considered. Brain edema may increase pressure in the cranial cavity and...

Ngày tải lên: 18/02/2014, 11:20

... MINIREVIEW Brain angiogenesis in developmental and pathological processes: neurovascular injury and angiogenic recovery after stroke Ken Arai, Guang Jin, Deepti Navaratna and Eng H. ... whether neurovascular responses after stroke can be reinter- preted in the context of angiogenesis in the brain. Is it possible that some of the acute neurovascular...

Ngày tải lên: 18/02/2014, 11:20

... activates adenylate cyclase (CyaA) and leads to an increase in the intra- cellular cyclic AMP (cAMP) level [1]. Mathematical models of catabolite repression in E. coli The (isolated) reactions of the ... key players of catabolite repression. Mathematical modelling of signal transduction and gene expres- sion of the enzymes involved in the transport of carbohydrate...

Ngày tải lên: 18/02/2014, 13:20

... Vitellogenin, in the mosquito Aedes aegypti. Mol Cell Endocrinol 267, 97–105. 20 Velarde RA, Robinson GE & Fahrbach SE (2006) Nuclear receptors of the honey bee: annotation and expression in the ... reorganization of the follicular epithelium in the resulting adults [40]. DmE75A and DmE75B have been implicated in defining the transition stages 8 and 9 o...

Ngày tải lên: 18/02/2014, 13:20

... interaction stability at will; in particular, the ability to increase stability by kinetic design. For example, by achieving this predominantly by decelerating unfolding ⁄ dissocia- tion rates (which in our case ... change the stability of the dimeric structure by accelerating the association ⁄ folding rate (these processes are concomitant) and decreasing th...

Ngày tải lên: 18/02/2014, 13:20

... wild-type PINK1, Parkin and DJ-1 may be key components of neuroprotective signalling cascades that run in parallel, interact via cross talk or converge in a common pathway. Abbreviations AR-JP, autosomal-recessive ... LRRK2 and ATP1 3A2 cause autosomal-dominant forms of parkinsonism. Mutations in the genes encoding Parkin, DJ-1 and PINK1 all cause autosomal-recessive parkinso...

Ngày tải lên: 18/02/2014, 14:20

... pathways in genetic Parkinson’s disease: Potential role of ceramide metabolism in Lewy body disease Jose Bras 1,2 , Andrew Singleton 1 , Mark R. Cookson 3 and John Hardy 4,5 1 Molecular Genetics ... studies of this question have been published to date. In this minireview, we have brought together data suggesting that some of the genes involved in the gene...

Ngày tải lên: 18/02/2014, 14:20

Ngày tải lên: 07/08/2014, 18:21

... Access Methodology Dose reduction to normal tissues as compared to the gross tumor by using intensity modulated radiotherapy in thoracic malignancies Tejinder Kataria* 1 , Sheh Rawat 1 , SN Sinha 2 , ... purpose of this paper is to evaluate the impact of IMRT in reducing the dose to the critical normal tissues while maintaining the desir...

Ngày tải lên: 09/08/2014, 10:21

... substituted for Uj using adaptive rejection sampling; Original article Bayesian inference in the semiparametric log normal frailty model using Gibbs sampling Inge Riis Korsgaard* Per ... illustrates how a Bayesian analysis can be carried out in the semiparametric log normal frailty model using Gibbs sampling. In the version...

Ngày tải lên: 09/08/2014, 18:21

... (black arrow) to the time that clinically evident brain herniation appeared (grey arrow). Figure 2 CT scan images after clinical signs of brain herniation developed . (A) Basal ganglia hemorrhage ... gradients are present. Conclusions Intraparenchymal pressure probes placed in the hemi- sphere contralateral to an intracerebral hematoma may dramatically underestimate ICP and render appa...

Ngày tải lên: 11/08/2014, 02:21

... level intensive care physicians, and conversely it requires the intensivist to have access to the intensive care unit (ICU). The strategic use of information technology (IT) has become one of the ... those in the ICU and to interact in a human way with the environment. This involves the use of a robot that projects the image of the physician in real-time onto a...

Ngày tải lên: 12/08/2014, 22:22