Báo cáo khoa học: " Modulatory effects of chitosan adipate on the T and B lymphocyte subsets in mice" pps

... alt ="" < /b> alt ="" < /b> alt ="" < /b> alt ="" < /b> alt ="" < /b>

Ngày tải lên: 07/08/2014, 18:21

... GCCTGGCAGCTGGAAGACAAATAC ATGGCCAAAATCACAAGGGTTAGC ABCC1 1119–1670 AGTGGAACCCCTCTCTGTTTAAG CCTGATACGTCTTGGTCTTCATC ABCC4 3880–4124 TGATGAGCCGTATGTTTTGC CTTCGGAACGGACTTGACAT ABCC5 3692–3864 AGAGGTGACCTTTGAGAACGCA ... binding to the < /b> substrate-binding sites and < /b> not the < /b> nucleotide binding sites. The < /b> fact that quercetin inhibited MRP1-, MRP4- and < /b> MRP5-mediated...

Ngày tải lên: 07/03/2014, 21:20

... mutations. These observations suggest that the < /b> defective detach- ment reaction, rather than the < /b> reduced ATPase activ- ity, is responsible for the < /b> phenotypic defects caused by the < /b> mutations. The < /b> ... activity of < /b> the < /b> MukB head While we were probing the < /b> mutational effects < /b> on < /b> the < /b> detachment reaction we unexpectedly noted...

Ngày tải lên: 23/03/2014, 05:22

... an important role in the < /b> synergistic induction of < /b> the < /b> SAA gene and < /b> the < /b> anti-IL-6 receptor monoclonal antibody inhibits the < /b> synergistic induction of < /b> SAA [21]. These findings indicate that IL- 6RA ... be explained by the < /b> fact that signal transduction of < /b> IL-1 or TNF-alpha is more strongly involved in the < /b> regulation of < /...

Ngày tải lên: 09/08/2014, 08:23

... a potentially stabilizing S-H-N interaction (Fig. 9B) [49]. The < /b> above discussion rationalizes the < /b> observed effects < /b> of < /b> the < /b> Y74W mutation in PfTIM on < /b> the < /b> stability of < /b> the < /b> dimeric structure and < /b> catalytic ... sug- gesting that the < /b> loss of < /b> activity at low concentration may be attributed to subunit dissociation....

Ngày tải lên: 18/02/2014, 11:20

... activity is a subject that merits our attention. The < /b> site of < /b> action of < /b> quinolone antibiotics has been determined to be on < /b> the < /b> gyrA sub- unit of < /b> the < /b> enzyme, due to the < /b> ability of < /b> the < /b> mutation of < /b> ... whereas the < /b> N-terminal segment has the < /b> ability to bind to DNA according to its acetylation and < /b> met...

Ngày tải lên: 18/02/2014, 14:20

... forma- tion, with the < /b> level of < /b> foci formation obtained for the < /b> empty vector control point set to 100%. In the < /b> SRblow point, one-fifth the < /b> usual amount of < /b> SRb expression construct was introduced. The < /b> graph shows ... likely contribution of < /b> other regions of < /b> the < /b> Mxi1-SRa protein. In the < /b> future, it would be important...

Ngày tải lên: 18/02/2014, 16:20

... resistant to conventional toxins [33–35], shows great promise. One of < /b> the < /b> major drawbacks of < /b> using these toxins is that they must be able to preserve the < /b> main characteristics of < /b> the < /b> toxin during the < /b> ... numbers are indicated on < /b> the < /b> right. The < /b> ‘+’ symbol represents the < /b> amino acid residues of < /b> the < /b> heparin-...

Ngày tải lên: 19/02/2014, 06:20

... results indicate that the < /b> maximal rate of < /b> the < /b> mutant EF-Ts in protein synthesis in vivo is  70%ofthatofthe wild-type EF-Ts. The < /b> studies of < /b> the < /b> effect of < /b> the < /b> EF-Ts mutation under starvation conditions ... D 420 value of < /b> the < /b> culture at the < /b> interception point between the < /b> exponential and < /b> the < /b> Ô...

Ngày tải lên: 21/02/2014, 00:20

... activity, thereby providing further strength to the < /b> argument that additional mecha- nisms, other than the < /b> inhibition of < /b> NF-jB, account for the < /b> inhibition by dexamethasone. However, the < /b> basis of < /b> ... ligand-binding studies (Fig. 6). It is pos- sible that at these high concentrations RU486 is acting in a GR-independent manner. Notwithstanding the < /b...

Ngày tải lên: 07/03/2014, 16:20