Báo cáo khoa học: " Modulatory effects of chitosan adipate on the T and B lymphocyte subsets in mice" pps
... alt ="" < /b> alt ="" < /b> alt ="" < /b> alt ="" < /b> alt ="" < /b>
Ngày tải lên: 07/08/2014, 18:21
... GCCTGGCAGCTGGAAGACAAATAC ATGGCCAAAATCACAAGGGTTAGC ABCC1 1119–1670 AGTGGAACCCCTCTCTGTTTAAG CCTGATACGTCTTGGTCTTCATC ABCC4 3880–4124 TGATGAGCCGTATGTTTTGC CTTCGGAACGGACTTGACAT ABCC5 3692–3864 AGAGGTGACCTTTGAGAACGCA ... binding to the < /b> substrate-binding sites and < /b> not the < /b> nucleotide binding sites. The < /b> fact that quercetin inhibited MRP1-, MRP4- and < /b> MRP5-mediated...
Ngày tải lên: 07/03/2014, 21:20
... mutations. These observations suggest that the < /b> defective detach- ment reaction, rather than the < /b> reduced ATPase activ- ity, is responsible for the < /b> phenotypic defects caused by the < /b> mutations. The < /b> ... activity of < /b> the < /b> MukB head While we were probing the < /b> mutational effects < /b> on < /b> the < /b> detachment reaction we unexpectedly noted...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: "Early administration of IL-6RA does not prevent radiation-induced lung injury in mice" pot
... an important role in the < /b> synergistic induction of < /b> the < /b> SAA gene and < /b> the < /b> anti-IL-6 receptor monoclonal antibody inhibits the < /b> synergistic induction of < /b> SAA [21]. These findings indicate that IL- 6RA ... be explained by the < /b> fact that signal transduction of < /b> IL-1 or TNF-alpha is more strongly involved in the < /b> regulation of < /...
Ngày tải lên: 09/08/2014, 08:23
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... a potentially stabilizing S-H-N interaction (Fig. 9B) [49]. The < /b> above discussion rationalizes the < /b> observed effects < /b> of < /b> the < /b> Y74W mutation in PfTIM on < /b> the < /b> stability of < /b> the < /b> dimeric structure and < /b> catalytic ... sug- gesting that the < /b> loss of < /b> activity at low concentration may be attributed to subunit dissociation....
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt
... activity is a subject that merits our attention. The < /b> site of < /b> action of < /b> quinolone antibiotics has been determined to be on < /b> the < /b> gyrA sub- unit of < /b> the < /b> enzyme, due to the < /b> ability of < /b> the < /b> mutation of < /b> ... whereas the < /b> N-terminal segment has the < /b> ability to bind to DNA according to its acetylation and < /b> met...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt
... forma- tion, with the < /b> level of < /b> foci formation obtained for the < /b> empty vector control point set to 100%. In the < /b> SRblow point, one-fifth the < /b> usual amount of < /b> SRb expression construct was introduced. The < /b> graph shows ... likely contribution of < /b> other regions of < /b> the < /b> Mxi1-SRa protein. In the < /b> future, it would be important...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc
... resistant to conventional toxins [33–35], shows great promise. One of < /b> the < /b> major drawbacks of < /b> using these toxins is that they must be able to preserve the < /b> main characteristics of < /b> the < /b> toxin during the < /b> ... numbers are indicated on < /b> the < /b> right. The < /b> ‘+’ symbol represents the < /b> amino acid residues of < /b> the < /b> heparin-...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx
... results indicate that the < /b> maximal rate of < /b> the < /b> mutant EF-Ts in protein synthesis in vivo is 70%ofthatofthe wild-type EF-Ts. The < /b> studies of < /b> the < /b> effect of < /b> the < /b> EF-Ts mutation under starvation conditions ... D 420 value of < /b> the < /b> culture at the < /b> interception point between the < /b> exponential and < /b> the < /b> Ô...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Differential effects of RU486 reveal distinct mechanisms for glucocorticoid repression of prostaglandin E2 release docx
... activity, thereby providing further strength to the < /b> argument that additional mecha- nisms, other than the < /b> inhibition of < /b> NF-jB, account for the < /b> inhibition by dexamethasone. However, the < /b> basis of < /b> ... ligand-binding studies (Fig. 6). It is pos- sible that at these high concentrations RU486 is acting in a GR-independent manner. Notwithstanding the < /b...
Ngày tải lên: 07/03/2014, 16:20