Báo cáo khoa học: " Excitability scores of goats administered ascorbic acid and transported during hot-dry conditions" potx

... l M C-peptide in the presence of insulin (C) and of 100 l M C-peptide in the presence of NaCl and formamide (D) under native conditions. J. Lind et al. Structure of C-peptide oligomeric states FEBS Journal ... time and analyzed under native conditions. Oligomer distribu- tion of 100 l M proinsulin C-peptide in the presence of divalent Ca 2+ and Mg 2+ ions und...

Ngày tải lên: 18/02/2014, 04:20

... the involvement of DNA gyrase in the antimicrobial effects of H4-(8 6–1 00) and related compounds was obtained in vitro by the mea- surement of their inhibitory activity on the supercoiling of pBR322 ... those of the inactive antimicrobial fragments HNb-( 1–1 3) and HNb-( 3–1 3) (Table 2) were not signifi- cant (Fig. 6B). The antimicrobial and anti -DNA...

Ngày tải lên: 18/02/2014, 14:20

... arginine. F. Shi et al. Saccharomyces cerevisiae NADH kinases FEBS Journal 272 (2005) 33373349 ê 2005 FEBS 3343 Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) ... vector complemented the poor growth of the pos5 cell on SG solid medium and on and in solid and liquid media lacking arginine (Fig. 5 and Table 6), ther...

Ngày tải lên: 20/02/2014, 01:20

... using primers (5Â-CGTCAAGGAGAAAAAAC CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC TGAAGAGGATCTG -3Â) and (5Â- GCATGC CTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3Â), and checked for the presence and ... (5Â-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3Â); for OR17-40 (5Â-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3Â) and (5Â-GCATG CCTGCAGGTCGACTCTAGAGGATCT...

Ngày tải lên: 07/03/2014, 16:20

... July 1993. 480 A Bag of Useful Techniques for Efficient and Robust Parsing Bernd Kiefer t, Hans-Ulrich Kriegert, John Carroll $, and Rob Malouff IGerman Research Center for Artificial Intelligence ... $Cognitive and Computing Sciences, University of Sussex Falmer, Brighton BN1 9QH, UK *Center for the Study of Language and Information, Stanford University...

Ngày tải lên: 08/03/2014, 06:20

... 269) 4389 Identification of microsomal rat liver carboxylesterases and their activity with retinyl palmitate Sonal P. Sanghani, Wilhelmina I. Davis, Natividad G. Dumaual, Alan Mahrenholz and William ... and ES3, account for more than 95% of rat liver microsomal carboxylesterase activity. They obey Michaelis– Menten kinetics for hydrolysis of retinyl p...

Ngày tải lên: 08/03/2014, 10:20

... for the expression of po- 2A very good introduction and summary of the range of meanings and forms devoted to aspects of politeness in Japanese is given in Migutani and Misutani (1987). liteness ... ASPECTS OF CLAUSE POLITENESS IN JAPANESE: AN EXTENDED INQUIRY SEMANTICS TREATMENT John A. Bateman* USC/Information Sciences Institute 4676 Admiralty Way, Suit...

Ngày tải lên: 08/03/2014, 18:20

... Sahin et al. (Eur. J. Biochem. 271) Ó FEBS 2004 Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation Bogachan Sahin 1 , Janice ... E-mail: james.bibb@utsouthwestern.edu Abbreviations: AK, adenosine kinase; Ado, adenosine; hAK, human adenosine kinase; mAK, mouse adenosine kinase. Note...

Ngày tải lên: 16/03/2014, 18:20

... create their active sites, eliminating the 4866 T.V. Rotanova et al.(Eur. J. Biochem. 271) Ó FEBS 2004 Classification of ATP-dependent proteases Lon and comparison of the active sites of their proteolytic ... The structure of the subcloned PCR fragment was verified by DNA sequencing. Expression of the lon gene and purification of Lon protease...

Ngày tải lên: 16/03/2014, 18:20

... Proceedings of ACL-08: HLT, pages 165–173, Columbus, Ohio, USA, June 2008. c 2008 Association for Computational Linguistics Trainable Generation of Big-Five Personality Styles through Data-driven Parameter ... discussion of related work to Section 4, where we summarize and discuss future work. 2 Parameter Estimation Models The data-driven parameter estimation method...

Ngày tải lên: 17/03/2014, 02:20

... 221–233. 26. Zabel, P., Dorssers, L., Wernars, K. & VanKammen, A. (1981) Terminal uridylyl transferase of Vigna unguiculata:purification Ó FEBS 2003 Characterization of U6 terminal uridylyltransferase ... The molecular mass (kDa) of marker proteins (m) is indicated on the left. 978 R. Trippe et al.(Eur. J. Biochem. 270) Ó FEBS 2003 Biochemical characterization of a...

Ngày tải lên: 17/03/2014, 09:20

... con- strain the ability of the RNase A entities to adopt the same orientation in the crystal as monomeric RNase A. On the other hand, the decreased activity of the RATEs as compared with RNase A ([16] ... mode of binding of RI to the RNase A tandem enzymes. Modeling studies with the crystal structures of the RI RNase A complex and...

Ngày tải lên: 22/03/2014, 16:21

... Identification of rice TUBBY-like genes and their evolution Qingpo Liu School of Agriculture and Food Science, Zhejiang Forestry University, Hangzhou, Lin’an, China TUBBY-like proteins ... description of the whole rice TUBBY-like gene family will aid in our understanding of the function of TULPs in plants. Results and Discussion Identification and seque...

Ngày tải lên: 23/03/2014, 07:20

... ê 2007 FEBS Differential susceptibility of Plasmodium falciparum versus yeast and mammalian enolases to dissociation into active monomers Ipsita Pal-Bhowmick, Sadagopan Krishnan and Gotam K. ... report successful dissociation of dimeric enolases from Plas- modium falciparum, yeast and rabbit muscle into active and isolatable monomers. Dimeric...

Ngày tải lên: 23/03/2014, 09:20

...

Ngày tải lên: 07/08/2014, 18:21