Báo cáo khoa học: "BSE situation and establishment of Food Safety Commission in Japan" pot

Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

Tài liệu Báo cáo khoa học: Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

... Affinity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells Seyed A. Mousavi 1 , Knut E. Berge 1 , Trond Berg 2 and Trond ... low-density lipoprotein receptor; LPDS, lipoprotein- depleted serum; PCSK9, proprotein convertase subtilisin ⁄ kexin type 9; PCSK9-WT,...

Ngày tải lên: 14/02/2014, 14:20

13 713 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... The Authors Journal compilation ê 2009 FEBS 135 Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio ... proteins, a leucine zipper domain and a C2H2 zinc finger domain, both of which are thought to help mediate DNA binding and may be involved in the...

Ngày tải lên: 16/02/2014, 09:20

20 690 0
Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs pdf

... Journal compilation ê 2009 FEBS 4135 Molecular cloning and characterization of soybean protein disulfide isomerase family proteins with nonclassic active center motifs Kensuke Iwasaki 1 , Shinya ... (2008) A novel plant protein disulfide isomerase family homologous to animal P5 – molecular cloning and characterization as a functional protein fo...

Ngày tải lên: 18/02/2014, 11:20

12 622 0
Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt

Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt

... is a direct target of SREBP [20]. The role of SREBP- 1a in the regulation of cell growth and the cell cycle might be biphasic and complex, and needs to be further investigated. SREBP is evolutionarily ... (2009) 616621 ê 2008 The Author Journal compilation ê 2008 FEBS 621 SREBP- 1c and lipogenesis The SREBP family consists of three isoforms: SREBP- 1a,...

Ngày tải lên: 18/02/2014, 13:20

6 574 1
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

... BMP -R-Smad ortholog from S. mansoni FEBS Journal 274 (2007) 40754093 ê 2007 The Authors Journal compilation ê 2007 FEBS 4093 Identification and characterization of an R-Smad ortholog (SmSmad1B) from ... parasite Schistosoma mansoni has a complex life cycle consisting of both free-living and host-dependent stages. The signaling mechanisms underlying the grow...

Ngày tải lên: 18/02/2014, 16:20

19 655 0
Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

... is the relative frequency of a pair of given link degrees,P R (k 0 , k 1 ) is the same frequency but for a randomized network with the C. Rodriguez-Caso et al. Human transcription factor network ... parameters of some real networks: Human transcription factor network (HTFN); Erdo ă s-Re nyi (ER) null model network with N identical to that of the present st...

Ngày tải lên: 19/02/2014, 07:20

12 511 0
Tài liệu Báo cáo khoa học: Antifungal effects and mechanism of action of viscotoxin A3 docx

Tài liệu Báo cáo khoa học: Antifungal effects and mechanism of action of viscotoxin A3 docx

... Analysis of the fungicidal effect of viscotoxin A 3 FEBS Journal 273 (2006) 7283 ê 2005 The Authors Journal compilation ê 2005 FEBS 79 Antifungal effects and mechanism of action of viscotoxin ... different types of cell, including animal, bacterial and fungal. The aim of this study was to obtain information on the cell targets and the mechanism of action...

Ngày tải lên: 19/02/2014, 07:20

12 530 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

... functions in dorsal–ventral patterning in early embryonic development and in the antimicrobial immune response in larvae and adults. We have investigated the function of Spa ă tzle in a lepidopteran insect, ... conserved in the immune system of a lepidopteran insect, suggesting that a cytokine- activated Toll path- way is an ancient feature of...

Ngày tải lên: 06/03/2014, 09:22

15 541 0
Báo cáo khoa học: Purification and characterization of the cysteine proteinases in the latex of Vasconcellea spp. ppt

Báo cáo khoa học: Purification and characterization of the cysteine proteinases in the latex of Vasconcellea spp. ppt

... Vasconcellea spp.: (1) a higher protein content in their latex; and (2) the pres- ence of other cysteine proteinases or isoforms in the latex. To investigate these two hypotheses, the protein concentration ... of enzymes in the latex of Vas- concellea fruits, but in addition also results from the presence of other cysteine proteinases or isoforms. I...

Ngày tải lên: 07/03/2014, 11:20

12 525 0
Báo cáo khoa học: Antioxidant defences and homeostasis of reactive oxygen species in different human mitochondrial DNA-depleted cell lines pot

Báo cáo khoa học: Antioxidant defences and homeostasis of reactive oxygen species in different human mitochondrial DNA-depleted cell lines pot

... q 0 cells (Eur. J. Biochem. 271) 3651 Antioxidant defences and homeostasis of reactive oxygen species in different human mitochondrial DNA-depleted cell lines Lodovica Vergani 1 , Maura Floreani 2 , ... q 0 cells, and that there are cell line-to -cell line v ariations in intracellular antioxidant defences and ROS homeostasis. In fact among the st...

Ngày tải lên: 16/03/2014, 18:20

11 412 0
Báo cáo khoa học: Identification and characterization of novel PKA holoenzymes in human T lymphocytes pdf

Báo cáo khoa học: Identification and characterization of novel PKA holoenzymes in human T lymphocytes pdf

... one-third of the PKI-inhibited activity was released into the extract, indi- cating that the precipitated Cb2 colocalized with Ca1on RIa and RIIa in a ratio of 2 : 1. Of the total PKA kin- ase activity, ... Cb2 activity in Cb2-transfected 29 3T cells was precipitated. Taken together it is there- fore reasonable to assume that Cb2 activity may consti- tute more than 20% of tot...

Ngày tải lên: 16/03/2014, 18:20

9 406 0
Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot

Báo cáo khoa học: "THE SYNTAX AND SEMANTICS OF USER-DEFINED MODIFIERS IN A TRANSPORTABLE NATURAL LANGUAGE PROCESSOR" pot

... portable natural language data base interface. Cmlf. on Ap'1)lied Nc~t~ral L~znguage Processing, Santa Munica, Ca., 1983, pp. 25-30. 25. Grosz, B. TEAM: A transportable natural language ... grammatical formalism for transportable natural language processing, llm~r. J. Cow~p~t~zt~na~ L~n~ist~cs, to appear. Biermann, A. and Ballard, B. Toward natural langu...

Ngày tải lên: 17/03/2014, 19:21

5 453 0
Báo cáo khoa học: Diversity, taxonomy and evolution of medium-chain dehydrogenase/reductase superfamily pot

Báo cáo khoa học: Diversity, taxonomy and evolution of medium-chain dehydrogenase/reductase superfamily pot

... Furthermore, recruit- ment of selected members of this superfamily may offer clues about the evolution of some metabolic pathways, and show the evolutionary history of different organisms: for example, ... H. Riveros-Rosas et al. (Eur. J. Biochem. 270) Ó FEBS 2003 Diversity, taxonomy and evolution of medium-chain dehydrogenase/reductase superfamily He ´ ctor Riv...

Ngày tải lên: 31/03/2014, 07:20

26 286 0
báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx

báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx

... article The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway Cinzia Comino 1 , Alain Hehn 2 , Andrea Moglia 1 , Barbara Menin 1 , Frédéric ... GGGTTTCATATGACTATCGGAGCTCGTGAT HQT-Rev CGGGATCCCTAGAAGTCATACAAGCATTT HCT-ForRT TTTTTAAGCTAACACGAGAC HCT-RevRT TCTCATAGGAGCTGTAATTG HQT-ForRT TAAAATGGACGATCAGTATC H...

Ngày tải lên: 12/08/2014, 03:20

13 650 0
w