Báo cáo khoa học: " Expression of tyrosine kinase A in the cerebral cortex of postnatal developing rat" docx

Báo cáo khoa học: Monomeric molten globule intermediate involved in the equilibrium unfolding of tetrameric duck d2-crystallin pdf

Báo cáo khoa học: Monomeric molten globule intermediate involved in the equilibrium unfolding of tetrameric duck d2-crystallin pdf

... secondary structural changes are minimal. The drastic increase of hydrophobic patches strongly suggests that there is a molten globule intermediate [26]. This may be the reason why an off-pathway inter- mediate ... subunit of the tetrameric d-crystallin shows a surface with several convex and concave areas as indicated by a , ÔbÕ and ÔcÕ, which participate in subunit associati...

Ngày tải lên: 08/03/2014, 08:20

8 426 0
Báo cáo khoa học: Cellular response to unfolded proteins in the endoplasmic reticulum of plants pptx

Báo cáo khoa học: Cellular response to unfolded proteins in the endoplasmic reticulum of plants pptx

... of ricin A chains. These stabilized ricin A chains are partly deglycosylated by a peptide–N-glycanase-like activity. Taken together, these results indicate that the ricin A chain behaves as a ... the absence of a B chain [152]. The degrada- tion of ricin A chain is brefeldin A- insensitive and is inhibited by the proteasome inhibitor clasto-lactacystin b-lactone,...

Ngày tải lên: 16/03/2014, 11:20

20 439 0
Báo cáo khoa học: "Hardness and basic density variation in the juvenile wood of maritime pine" ppt

Báo cáo khoa học: "Hardness and basic density variation in the juvenile wood of maritime pine" ppt

... (table I). Formula 3 was also used to calculate the effects in each tree, by using the means in the tree instead of the means in the whole class, so that, finally, the ... a radial gradient of approximately 40 % (based on the value measured in the first two annual rings) between the pith and the 20th annual ring at breast...

Ngày tải lên: 08/08/2014, 14:21

13 468 0
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

... kinase A in the mitochondrial targeting of CYP2E1 Naresh B. V. Sepuri, Sanjay Yadav, Hindupur K. Anandatheerthavarada and Narayan G. Avadhani Department of Animal Biology, School of Veterinary ... erythromycin, was preincubated for 3 min. The reaction was initiated by the addition of 3 mm NADPH, and continued for 30 min at 37 °C in a shaking water bath. The reaction...

Ngày tải lên: 18/02/2014, 16:20

16 651 0
Báo cáo khoa học: Expression level and agonist-binding affect the turnover, ubiquitination and complex formation of peroxisome proliferator activated receptor b pptx

Báo cáo khoa học: Expression level and agonist-binding affect the turnover, ubiquitination and complex formation of peroxisome proliferator activated receptor b pptx

... protecting the cell against the overexpression of PPARb in pathophysiological conditions. Further- more, our findings indicate that the experimental data obtained by the overexpression of PPARs have ... oligomerization. Decreasing amounts of pCMX-mPPARb and pCDNA3.1zeo-3xFlag-mPPARb were trans- fected into HEK293 cells as in (A) . All samples contained a total amount of 1...

Ngày tải lên: 30/03/2014, 03:20

9 350 0
Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

... in various organ systems. Even in organisms lacking a brain, such as Caenorhabditis elegans, the nervous system plays a key role in maintaining energy balance [1–4]. In more advanced, mammalian ... feeding behavior and body weight. ACC, acetyl-CoA car- boxylase; AMPK, 5¢ AMP kinase; CPT, carnitine palmitoyltransfer- ase; FAS, fatty acid synthase; MCD, malonyl-CoA decarboxylase;...

Ngày tải lên: 14/02/2014, 22:20

7 679 0
Báo cáo khoa học: Many fructosamine 3-kinase homologues in bacteria are ribulosamine⁄erythrulosamine 3-kinases potentially involved in protein deglycation docx

Báo cáo khoa học: Many fructosamine 3-kinase homologues in bacteria are ribulosamine⁄erythrulosamine 3-kinases potentially involved in protein deglycation docx

... homologues Lactobacillus plantarum GTT CATATGCACTTAACAAAAACTTGG NdeI pET15b BL21(DE3) LB a Ap c 18 °C16h GAG GGATCCATTAATATTGCATGAGAATTC BamHI pLysS Cm d Enterococcus faecium AACATATGGATATCCAAACTGTTTTATC ... °C16h GGCAGC GGATCCTACCCCTCTTTCAAATTTGCATC BamHI Cm Staphylococcus aureus PtpB GCAGCG CATATGAAGATTCTATTCGTTTGTACAG NdeI pET 3a BL21(DE3)plysS LB Ap 18 °C16h GGCAGC GGATCCTAGCAAATAATATC...

Ngày tải lên: 07/03/2014, 05:20

15 533 0
Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

Báo cáo khoa học: Death inducer obliterator protein 1 in the context of DNA regulation Sequence analyses of distant homologues point to a novel functional role docx

... the minimal transcrip- tionally active fragment and are required simulta- neously to maintain transcription. The PHF3 protein was recovered in initial analyses and also contains a TFS2M domain ... protein domain architectures that share a canonical bipartite nuclear localization signal and a PHD domain (Zn finger) at the N-terminal region. The long isoform also contains transcr...

Ngày tải lên: 07/03/2014, 21:20

7 658 0
Báo cáo khoa học: Alpha 1,3-fucosyltransferase-VII regulates the signaling molecules of the insulin receptor pathway potx

Báo cáo khoa học: Alpha 1,3-fucosyltransferase-VII regulates the signaling molecules of the insulin receptor pathway potx

... proteolysis of b-catenin. During activation of the InR pathway, GSK-3 is inactivated, which leads to the accumulation and nuclear translocation of cyto- plasmic unphosphorylated b-catenin. In nuclei, ... insulin-responsive cells in diabetic patients was changed. This may reveal the role of the sugar chains on InR in the pathogenesis of diabetes. In summary, the c...

Ngày tải lên: 16/03/2014, 12:20

13 354 0
w