Báo cáo khoa học: "Biochemical characteristics and antimicrobials susceptibility of Salmonella gallinarum isolated in Korea" pot

... (0.08) 14 86 (780) 10 08 (19 ) Helix III (4 3–5 2) 0.87 (0.06) 18 85 ( 710 ) 15 96 ( 51) Helix III (5 3–5 9) 0.82 (0.09) 10 30 ( 613 ) 905 ( 21) Helix III (4 2–5 6) 0.87 (0.06) 16 30 (809) 12 97 (37) Helix III ( 51 56) ... 2007 FEBS Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain hints from 15...

Ngày tải lên: 18/02/2014, 16:20

... Authors Journal compilation ê 2008 FEBS 1987 Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus Yuhong Han 1,2, *, Feijuan ... semipreparative column was from Agilent Tech- nologies (Santa Clara, CA, USA), and trifluoroacetic acid and acetonitrile used for HPLC were from Merck (Darms- tadt,...

Ngày tải lên: 18/02/2014, 17:20

... compilation ê 2008 FEBS 2019 The antibacterial and antifungal properties of trappin-2 (pre-elafin) do not depend on its protease inhibitory function Ke ´ vin Baranger, Marie-Louise Zani, Jacques Chandenier, ... h of incubation with either molecule than at the start of the incubation. Antifungal activities of trappin-2 and trappin-2 A62D ⁄ M6...

Ngày tải lên: 18/02/2014, 17:20

... with the 1–245 N-terminal domain of the putative replica- tion protein from the S. solfataricus plasmid pIT3. Furthermore, a longer variant (Rep516) comprising the 1–516 N-terminal residues of the ... tri -functional monomeric primase–polymerase domain encoded by the plasmid pIT3 from Sulfolobus solfataricus strain IT3 was identified using a structura...

Ngày tải lên: 18/02/2014, 18:20

... 2006 The Authors Journal compilation ê 2006 FEBS Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori Cong Han 1 , Lirui Wang 1 , Kunqian Yu 1 , ... enco- ding SDH from H. pylori strain SS1. The recombinant H. pylori shikimate dehydrogenase (HpSDH) was cloned, expressed, and purified in E. coli system, and...

Ngày tải lên: 19/02/2014, 05:20

... of tyrosine phos- phorylation. To investigate the involvement of src and PDGFR in tyrosine phosphorylation of S6K further, we studied the effect of inhibitors on tyrosine phosphorylation of S6Ks. ... (A) Deletion of the N-terminus leads to a loss of phos- photyrosine in S6K. Hek293 cells were transiently transfected with WT and truncated mutants of S6K (S6K1, S6K...

Ngày tải lên: 19/02/2014, 07:20

... diagram of crystal structure o f CD2 CD58 complex and crystal structure of rat CD2. (A) Ribbon diagram of crystal structure of CD2 CD58 (LFA-3) complex. Starting positions of peptides for docking ... tructure of the surface epitopes of the CD2 protein. Docking studies of CD2 peptides and CD58 protein revealed the possible binding sites of the cyclic...

Ngày tải lên: 19/02/2014, 13:20

... 2004 Regulation of iPLA 2 c biosynthesis (Eur. J. Biochem. 271) 4713 Complex transcriptional and translational regulation of iPLA 2 c resulting in multiple gene products containing dual competing ... heat- ing a 4-l M mixture of primers to 95 °C for 3 min followed by cooling to 22 °C prior to cloning into the Xho1/Sal1 sites of vector pEGFP-N3. Integri...

Ngày tải lên: 19/02/2014, 16:20

... Tumor necrosis factor-induced long myosin light chain kinase transcription is regulated by differentiation-dependent signaling events: characterization of the human long myosin light chain kinase promoter. ... N-terminal extension of the isoform of smooth muscle long myosin light chain kinase. Cell Res 16, 367–376. Aggregation domain in myosin lig...

Ngày tải lên: 30/03/2014, 04:20

... relative frequency of some gastrointestinal endocrine cells in aging mice have also been reported 19-21 . Regional Distribution and Relative Frequency of Gastrointestinal Endocrine Cells in Large Intestines ... cells in the large intestinal tract of C57BL/6 mice. Note that they were restricted to th e colon. ì480. Regional Distribution and R...

Ngày tải lên: 07/08/2014, 15:20

Ngày tải lên: 07/08/2014, 17:22

... days of age, probably because of the low number of birds (8 per line per sex). Original article Growth characteristics and lipid distribution in two lines of chicken selected ... reserve lipids.

Ngày tải lên: 09/08/2014, 22:22

... 29:162 http://www.jeccr.com/content/29/1/162 Page 8 of 8 RESEA R C H Open Access XAF1 expression and regulatory effects of somatostatin on XAF1 in prostate cancer cells Zhaoquan Xing 1† , Zunlin Zhou 2† , Rong Yu 3,4 , ... occur during the development of prostate cancer. It is interesting to evaluate the potential regulatory effects of somatostatin on...

Ngày tải lên: 10/08/2014, 10:20

... DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; Actin-For5'AAACCACAAGCCCCTAAACC, Rev5 'TTGCATCACTCAGCACCTTC. ... genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization Binod B Sahu* and Birendra P Shaw Address: Environmen...

Ngày tải lên: 12/08/2014, 03:20

... 10:5 http://www.biomedcentral.com/1471-2229/10/5 Page 6 of 11 RESEARC H ARTIC LE Open Access DNA polymorphisms and haplotype patterns of transcription factors involved in barley endosperm development are associated with key agronomic traits Grit ... article as: Haseneyer et al.: DNA polymorphisms and haploty pe patterns of transcription fact...

Ngày tải lên: 12/08/2014, 03:21