Báo cáo toán học: "Connectivity of the Lifts of a Greedoid" pot

... consideration of Contact Committee of the Heads of the SAIs of the European Union Luxembourg, 6 – 7 December 2004 (version 29 October 2004) based on education, training and experience, of ... finalisation of these Standards. The amended version was sent to EU SAIs and discussed at the Liaison Officers Meeting on 4-5 October. In conc...

Ngày tải lên: 06/03/2014, 23:20

... localization and I. Birschmann et al. Domain function of Pex1p and Pex6p FEBS Journal 272 (2005) 4758 ê 2004 FEBS 57 Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p Ingvild ... assigned their corresponding binding sites and elucidated the importance of ATP-binding and -hydrolysis of Pex1p and Pex6p...

Ngày tải lên: 07/03/2014, 16:20

... ể FEBS 2002 Chemical structure and immunoreactivity of the lipopolysaccharide of the deep rough mutant I-69 Rd /b + of Haemophilus inuenzae Sven Muă ller-Loennies, Lore Brade and Helmut Brade Research ... Medicine and Biosciences, Borstel, Germany From the lipopolysaccharide of the deep rough mutant I-69 Rd – /b + of Haemophilus influenz...

Ngày tải lên: 31/03/2014, 21:21

... purposes) Virology Journal Open Access Research Could FIV zoonosis responsible of the breakdown of the pathocenosis which has reduced the European CCR5-Delta32 allele frequencies? Eric Faure Address: ... environment. The aim of this article is to critically discuss the possible nature of this (or these) parasite(s) responsible of the decrease...

Ngày tải lên: 20/06/2014, 01:20

... to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Metabolite proving fungal cleavage of the aromatic core part of a fluoroquinolone ... provided all interpretations of the chemical raw data. All authors read and approved the final manuscript. Acknowledgements Part of this work w...

Ngày tải lên: 20/06/2014, 21:20

... class="bi x1 y0 w4 h 1" alt =""

Ngày tải lên: 05/08/2014, 10:20

... class="bi x0 y0 w1 h 1" alt =""

Ngày tải lên: 05/08/2014, 15:20

... years after the publication of A Handbook of Integer Sequences, a greatly expanded version of this collection can now be accessed by electronic mail. 1. The on-line version A Handbook of Integer ... if the sequence is not in the table), and furthermore will apply a series of transfor- mations to a given sequence and then look up the transformed sequences in the...

Ngày tải lên: 07/08/2014, 06:20

... one member of L. The H -covering number of G, denoted by cov(G, H), is the minimum number of members in an H -covering design of G.(IfthereisanedgeofGwhich cannot be covered by a copy of H,we put ... create a set L 4 of copies of K h ,beginningwithL 4 =∅, Efficient covering designs of the complete graph Yair Caro ∗ and Raphael Yuster † Department of Mathematics...

Ngày tải lên: 07/08/2014, 06:20

... of Connectedness and the Distribution of Number of Components Jason P. Bell Department of Mathematics University of California, San Diego La Jolla, CA 92903-0112, USA (email: jbell@math.ucsd.edu) Edward ... depends on the type of map, and A depends on both the type of map and the surface. See [22] for a proof of (7) for the unrooted case an...

Ngày tải lên: 07/08/2014, 06:20

... of the pth powers of all of the binomial coefficients of order n. There too, the methods described in [PWZ] can show that no closed form exists for specific fixed values of p, but the general question ... for sums of powers of binomial coefficients, J. Comb. Theory Ser. A 52 (1989), 77–83. [McI] Richard J. McIntosh, Recurrences for alternating sums of powers of...

Ngày tải lên: 07/08/2014, 06:22

... the proof of Lemma 2 in our proof of Theorem 1, we will include the full proof of Lemma 2 there. As examples of these lemmas, for the symmetric group, which has m = n(n − 1)/2 roots, the asymptotic ... covariance form of X.LetY N be the sum of N independent copies of X. For any vector v,letp(v) be the probability for the random walk, and let q(v) the...

Ngày tải lên: 07/08/2014, 08:22

... E 1 are the points of PG(6, 3) \ PG(5, 3); (ii) the lines of E 1 are the lines of PG(6, 3), not contained in PG(5, 3), which contain a point of K; (iii) incidence is derived from the one of PG(6, ... point x of PG(5, 3), define the generating index i K (x) of x as the minimal number of points of K which are necessary to generate a subspace containing x. Lemma 4....

Ngày tải lên: 07/08/2014, 21:21

... article Preliminary measurement and simulation of the spatial distribution of the Morphogenetically Active Radiation (MAR) within an isolated tree canopy Didier Combes a,b,* , Hervé Sinoquet b and Claude ... gradient of the mean transmittance existed from the bottom to the top of the tree crown. Like in the PAR domain, the variability o...

Ngày tải lên: 08/08/2014, 14:22

... ggatccatttaggtgacactatagaagtacctgaaaggaagcttttttttttcg aggatttcctgtatttattaagttacaagttggcaggcacagcttgagcaacat agaaaagtaatcttcttgagttatacaatcatttaaattccaaagcactcacaa aattgagcaaacaaagccactatttgcatatttgggaaaggaaacatattgct aacgtaagcttcctgaatccttcatggcctatagtgagtcgtattagaattc-3’ ). The synthesized riboprobe was precipitated by ... measured by liquid scintillation analysis. The probe for USP...

Ngày tải lên: 08/08/2014, 17:20