Báo cáo toán học: "Unification of the Quintuple and Septuple Product Identities" pps
Báo cáo khoa học: Identification of the amniotic fluid insulin-like growth factor binding protein-1 phosphorylation sites and propensity to proteolysis of the isoforms docx
... Identification of the amniotic fluid insulin-like growth factor binding protein-1 phosphorylation sites and propensity to proteolysis of the isoforms Lorenzo Dolcini1, Alberto Sala1, Monica Campagnoli1, ... variety of important physi-ological processes. Upon binding they regulate the availability of both insulin-like growth factors I and II(IGF-I and -II) and their affinity for these ligands ismodulated ... 2009)doi:10.1111/j.1742-4658.2009.07318.x Insulin-like growth factor binding protein-1 (IGFBP-1) is the majorsecreted protein of human decidual cells during gestation and, as a modula-tor of insulin-like growth factors or by...
- 14
- 469
- 0
Báo cáo khoa học: Identification of the structural determinant responsible for the phosphorylation of G-protein activated potassium channel 1 by cAMP-dependent protein kinase pdf
... Identification of the structural determinant responsible for the phosphorylation of G -protein activated potassium channel 1 by cAMP-dependent protein kinase Carmen Muăllner, Bibiane Steinecker, ... being activated by G -protein b ⁄ c subunits, G -protein activated potassium channels (GIRKs) are regulated by cAMP-dependent protein kinase. Back -phosphorylation experiments have revealed that the ... Sci USA 93, 14 193 14 198.28 Vivaudou M, Chan KW, Sui JL, Jan LY, Reuveny E &Logothetis DE (19 97) Probing the G -protein regulation of GIRK1 and GIRK4, the two subunits of the K-ACh channel, ...
- 9
- 403
- 0
Báo cáo Y học: Identification of the 19S regulatory particle subunits from the rice 26S proteasome potx
... homology to RP subunits. Ó FEBS 2002 The 19S regulatory particle from rice (Eur. J. Biochem. 269) 1479 Table 3. Identification of the rice 19S regulatory particle subunits by ESI-Q-TOF MS. myri, ... lot analysis of genes encoding six O sRpt subunits of the rice 19S regulatory particle. The rice genomic DNA was isolated from an individual grown from single seed of inbred strain (Oryza stiva ... each of whichcontains only one of the products of duplicated OsRp tgenes, may have s pecific functions.Fig. 3. Western blotting analysis of the rice 19S regulatory particle subunits. Purified rice...
- 10
- 495
- 0
Báo cáo khoa học: Identification of the heparin-binding domains of the interferon-induced protein kinase, PKR pptx
... the beads in the absence of activator; ds lanes, proteins bound to the beads in the presence of dsRNA and hep lanes,proteins bound to the beads in the presence of heparin. The names of the proteins ... perspective: Heparin-binding domains of PKR S. Fasciano et al.1438 FEBS Journal 272 (2005) 1425–1439 ª 2005 FEBS Identification of the heparin-binding domains of the interferon-induced protein kinase, PKR Stephen ... possible that the observed loss of kinase activityresults from a loss of one of the domains important for the catalytic activity of PKR, as unlike the dsRNA-binding domains, heparin-binding domains...
- 15
- 424
- 0
Báo cáo khoa học: Identification of the N-terminal region of TjZNT2, a Zrt⁄Irt-like protein family metal transporter, as a novel functional region involved in metal ion selectivity ppt
... The Authors Journal compilation ê 2011 FEBS Identification of the N-terminal region of TjZNT2, a Zrt⁄Irt-like protein family metal transporter, as a novel functional region involved in metal ... Comparative microarray analysis of Arabidopsis thaliana and Arabidopsis halleri roots identi-fies nicotianamine synthase, a ZIP transporter and othergenes as potential metal hyperaccumulation factors.Plant ... through the study of transcript regulation as a molecular biologicalapproach and the determination of the N-terminal sequence as a biochemical approach.Experimental proceduresDNA manipulationsThe...
- 8
- 343
- 0
Báo cáo khoa học: Classification of the short-chain dehydrogenase ⁄reductase superfamily using hidden Markov models potx
... giventhat the majority of the families are classical, 36% of the proteins are of the extended type. This means thatmany of the largest families are of the extended type.Classical SDRs are in the ... all of the membershave the largest number of identities with the humanrepresentatives in their own family. The first exceptionis the retinol dehydrogenase family SDR7C, where wefind a total of ... article, we apply hidden Markov models (HMMs) to obtain a sequence-basedsubdivision of the SDR superfamily that allows forautomatic classification of novel sequence data andprovides the basis for...
- 12
- 379
- 0
Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt
... of < /b> NADPH:< /b> protochlorophyllide< /b> oxidoreductases A < /b> and < /b> B: a < /b> branched pathway forlight-dependent chlorophyll biosynthesis in Arabidopsisthaliana. Plant Physiol 108, 1505–1517.3 Oosawa N, Masuda ... concentration or if blocked at the < /b> N-terminus [25].We show that the < /b> N-termini < /b> of < /b> PORA and < /b> PORB of< /b> barley and < /b> POR from pea are homologous, and < /b> thatPchlide cannot bind to the < /b> PORA transit peptide of< /b> pPORA ... indicated by colons, and < /b> weaker similarity is indicated by dots to illustrate the< /b> homology of < /b> the < /b> cleavage sites between PORA and < /b> PORB from barley and < /b> POR from pea. The < /b> complete protein sequence alignment...
- 8
- 362
- 0
Báo cáo khoa học: Identification of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx
... EcoRIAAAGAATTCTTACAGGTGAGGTCAGAAGCTGATThTF6 AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA BamHI ⁄ EcoRIAAAGAATTCTTAACCTGAAAGCGCCTGTGTAGhTF7 AAAGGATCCCCCAACAACAAAGAGGGATACT BamHI ⁄ EcoRIAAAGAATTCTTAGGTGCTGCTGTTGACGTAATAThTF8 ... EcoRIhTF5CcAAAGAATTCTTACTTGCCCGCTATGTAGACAAA BamHI ⁄ EcoRIhTF5DcAAAGAATTCTTAATCCTCACAATTATCGCTCTTATT BamHI ⁄ EcoRIhTF5EcAAAGAATTCTTACCCTACACTGTTAACACT BamHI ⁄ EcoRIhTF5FcAAAGAATTCTTAAACACTCCACTCATCACA ... EcoRIAAAGAATTCTTAGGTGCTGCTGTTGACGTAATAThTF8 AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA BamHI ⁄ EcoRIAAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTThTF 5A cAAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC BamHI ⁄ EcoRIhTF5BcAAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT BamHI...
- 10
- 308
- 0
Báo cáo toán học: " Further results of the estimate of growth of entire solutions of some classes of algebraic differential equations" docx
... text (HTML) versions will be made available soon. Further results of the estimate of growth of entire solutions of some classes of algebraic differential equationsAdvances in Difference Equations ... a number r ∈ (0, 1);2. a sequence of complex numbers zn, |zn| < r; Further results of the estimate of growth of entire solutions of some classes of algebraic differential equationsQi ... estimate the growth order of entire solutions of some algebraic differential equationsand improve the related results of Bergweiler, Barsegian, and others.We also estimate the growth order of...
- 18
- 391
- 0
Báo cáo toán học: "Homotopy invariance of the analytic index of signature operators over C*-algebras " pdf
... class="bi x0 y0 w1 h 1" alt ="" ...
- 15
- 211
- 0
Báo cáo toán học: "Cyclic cohomology of the group algebra of free groups " ppt
... class="bi x0 y1 w1 h 2" alt ="" ...
- 13
- 288
- 0
Báo cáo toán học: "A Presentation of the Elements of the Quotient Sheaves Ωk /Θk in Variational Sequences" pdf
... ΩNr→ 0.1. Introduction The notion of variational bicomplexes was introduced in studying the problem of characterizing the kernel and image of Euler-Lagrange mapping in the calcu-lus of variations. ... w0, (16) Vietnam Journal of Mathematics 33:3 (2005) 271–281A Presentation of the Elements of the Quotient Sheaves Ωkr/Θkr in Variational SequencesNong Quoc ChinhThai Nguyen University, ... called the Helmiholtz-Soninclass of (n +2)-forms.Below we give a concrete presentation of the elements in Ωkr/Θkrfor all pos-itive integer k satisfying n +1≤ k ≤ P in the case of r =1andr...
- 11
- 314
- 0
Báo cáo toán học: " COMBINATORIAL PROOFS OF CAPELLI’S AND TURNBULL’S IDENTITIES FROM CLASSICAL INVARIANT THEORY" potx
... dj= G. COMBINATORIAL PROOFS OF CAPELLI’S AND TURNBULL’S IDENTITIES FROM CLASSICAL INVARIANT THEORYBYDominique FOATA∗ and Doron ZEILBERGER∗∗0. Introduction. Capelli’s [C] identity ... Kostant and Sahi [K-S] discovered and provedan anti-symmetric analog of Capelli’s identity. Although we, at present,are unable to give a combinatorial proof similar to the above proofs, westate ... approach to Classical Invariant Theory. Capelli’s identity wasrecently considered by Howe [H] and Howe and Umeda [H-U]. Howe [H]gave an insightful representation-theoretic proof of Capelli’s...
- 10
- 279
- 0
Báo cáo toán học: " Some Applications of the Proper and Adjacency Polynomials in the Theory of Graph Spectra" docx
... that the graph Γiis the i-th class of the scheme, and so we indistinctly use the words graph or“class” to mean the same thing.2 The Proper and Adjacency Polynomials In this section we introduce ... trivial.) Then, by the converse of Theorem 2.5, it must be Qku≥ 1. On the other hand, in the proof of Theorem the electronic journal of combinatorics 4 (1997), #R21 3 In the rest of this introductory ... on the spectrum of the graph [17] . Afterwards, we further investigate some new applications of these polynomials, deriving new bounds for the radius of a graph and the “weight k-excess” of a...
- 27
- 283
- 0
Báo cáo toán học: "Unification of the Quintuple and Septuple Product Identities" pps
... form of the quintuple product identity. Two further finite forms have been given in the recent papers [7] and [20].4 The Septuple Product IdentitiesIn order to derive the generalized septuple product ... review the knownidentities such as the quintuple, sextuple and septuple products and establish several newtheta function identities through Section 3 to 5 in the rest of the paper.2 Main Theorem ... (−1)q(2)α+∞j=−∞(−1)j+jβγyjqλ(j2)γ+j(βγ+12)α−jαβγ. the electronic journal of combinatorics 14 (2007), #N7 3 [16] D. Foata and G. N. Han, The triple, quintuple and septuple product identities revis-ited, The Andrews Festschrift...
- 10
- 236
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ