Báo cáo khoa học:Restricted walks in regular trees docx

... (2006) Lung adenocarcinomas induced in mice by mutant EGF receptors found in human lung cancers respond to a tyrosine kinase inhibitor or to down-regulation of the receptors. Genes Dev 20, 1496–1510. 5 ... Ito F (2009) Mito- gen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor recepto...

Ngày tải lên: 16/02/2014, 09:20

... versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein Ilaria Sambi 1 , Pietro Gatti-Lafranconi 1 *, Sonia Longhi 2 and Marina Lotti 1 1 Dipartimento ... with a forward primer (5Â-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3Â) designed to introduce a hexahistidine tag and a ClaI restrictio...

Ngày tải lên: 18/02/2014, 04:20

... 2009) doi:10.1111/j.1742-4658.2009.07022.x The expression and localization of the proline-rich membrane anchor (PRiMA), an anchoring protein of tetrameric globular form acetylcholines- terase (G 4 AChE), were studied at vertebrate neuromuscular ... localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase a...

Ngày tải lên: 18/02/2014, 08:20

... are also interesting with regards to brain vas- culature, because they regulate the formation and main- tenance of BBB, modulate neurovascular coupling and maintain several parts of brain homeostasis. ... origin [78]. According to the monocyte hypothesis, during embryogenesis, and even in adults, migrating monocytes enter the brain via blood vessels and then differenti...

Ngày tải lên: 18/02/2014, 11:20

... VEGF-D, binds and activates this receptor, resulting in the proliferation and migration of lymph ECs and lymphangiogenesis [13]. Angiogenesis in brain diseases Brain stroke Stroke is induced through: ... among tissues in the body, and the risk of edema to brain functions should be carefully considered. Brain edema may increase pressure in the cranial cavity and...

Ngày tải lên: 18/02/2014, 11:20

... MINIREVIEW Brain angiogenesis in developmental and pathological processes: neurovascular injury and angiogenic recovery after stroke Ken Arai, Guang Jin, Deepti Navaratna and Eng H. ... whether neurovascular responses after stroke can be reinter- preted in the context of angiogenesis in the brain. Is it possible that some of the acute neurovascular...

Ngày tải lên: 18/02/2014, 11:20

... activates adenylate cyclase (CyaA) and leads to an increase in the intra- cellular cyclic AMP (cAMP) level [1]. Mathematical models of catabolite repression in E. coli The (isolated) reactions of the ... key players of catabolite repression. Mathematical modelling of signal transduction and gene expres- sion of the enzymes involved in the transport of carbohydrate...

Ngày tải lên: 18/02/2014, 13:20

... Vitellogenin, in the mosquito Aedes aegypti. Mol Cell Endocrinol 267, 97–105. 20 Velarde RA, Robinson GE & Fahrbach SE (2006) Nuclear receptors of the honey bee: annotation and expression in the ... reorganization of the follicular epithelium in the resulting adults [40]. DmE75A and DmE75B have been implicated in defining the transition stages 8 and 9 o...

Ngày tải lên: 18/02/2014, 13:20

... interaction stability at will; in particular, the ability to increase stability by kinetic design. For example, by achieving this predominantly by decelerating unfolding ⁄ dissocia- tion rates (which in our case ... change the stability of the dimeric structure by accelerating the association ⁄ folding rate (these processes are concomitant) and decreasing th...

Ngày tải lên: 18/02/2014, 13:20

... imposes. This includes some weak general obligations (such as acknowledging utterances by others and not inter- rupting) as well as some extra goals coming from the domain setting to maintain a shared ... plays the role of the dialogue manager in the TRAINS dialogue system which acts as an intelligent planning assistant in a transportation domain. While this is a domain where t...

Ngày tải lên: 20/02/2014, 21:20

... grammatical information appearing in the make entry below is a consequence of our maintaining the strong position that only infor- mation which is idiosyncratic should be included in a lexical ... while avoiding copy- ing information which can still be inherited; each rule takes as input a single-word lexical frame and produces a single-word lexical frame (no phrases in ei...

Ngày tải lên: 21/02/2014, 20:20

... challenging baseline methods. 1 Introduction This paper presents a method for debate-side clas- sification, i.e., recognizing which stance a per- son is taking in an online debate posting. In on- line ... Lin- guistics. Murthy Ganapathibhotla and Bing Liu. 2008. Mining opinions in comparative sentences. In Proceedings of the 22nd International Conference on Compu- tational Linguistic...

Ngày tải lên: 30/03/2014, 23:20

... translated into counting certain paths in the Cayley graph of F 2 , since each word in F 2 corresponds uniquely to a walk in the Cayley graph of F 2 , the in nite regular tree of degree four. In the ... point in T , and M, N two positive integers. Let W be the element in F r describing the path from the origin to P . Then the number of paths in T of length M + |U | + N beginn...

Ngày tải lên: 07/08/2014, 13:21

... for citation purposes) BMC Plant Biology Open Access Research article Restricted cell elongation in Arabidopsis hypocotyls is associated with a reduced average pectin esterification level Paul ... normal cell elongation in Arabidopsis hypocotyls. When the average DE% falls below this level, as in two gibberellic acid (GA) mutants ga1-3 and gai, and pla...

Ngày tải lên: 12/08/2014, 05:20

Ngày tải lên: 12/08/2014, 23:20