Báo cáo khoa học:When Can You Tile a Box With Translates of Two Given Rectangular Brick pot

... 2 When Can You Tile a Box With Translates of Two Given Rectangular Bricks? Richard J. Bower and T. S. Michael ∗ Mathematics Department, United States Naval Academy Annapolis, MD 21402 tsm@usna.edu Submitted: ... instance, Figure 1 shows two tilings of a box R with translates of two rectangular bricks B 1 and B 2 . In (a) the box R is partitioned by...

Ngày tải lên: 07/08/2014, 08:20

... (Nepean, Canada); Alamar blue reagent from Biosource (Montreal, Canada); paraformal- dehyde (PFA) from BDH Laboratories (Poole, UK); glia-specific rabbit GFAP antibody (Z0334) from Doko Cytomation ... tissues [25,26]. Hypoxia and hypoxia-related signaling have been associated with major pathologies, such as car- diovascular disease, stroke and cancer [27]. The sig- naling for hypoxia was of...

Ngày tải lên: 07/03/2014, 00:20

... Characters Shu-Kai Hsieh Institute of Linguistics Academia Sinica Taipei, Taiwan shukai@gate.sinica.edu.tw Chu-Ren Huang Institute of Linguistics Academia Sinica Taipei, Taiwan churen@gate.sinica.edu.tw Abstract This ... The character ontology: a snapshot 4.2 Characters in a Small World In addition, an experiment concerning the char- acter network that was based on the meaning as- pec...

Ngày tải lên: 31/03/2014, 01:20

... where a multiplicity of sentiments for a variety of topics and corresponding targets are potentially involved (Riloff and Wiebe., 2003; Sarmento et al., 2009). Alternative approaches to automatic ... specific target than negative opinions. We believe that the validation of this hypothesis requires a thorough study, based on a larger amount of data spanning more elector...

Ngày tải lên: 20/02/2014, 05:20

... min and 72 °C for 1 min, for 35 cycles using HF Taq DNA polymerase (Roche). For bcp4, the forward primer 5¢-CAAAATCTTT CATATGGTAGAAATAGG-3¢ and the reverse primer 5¢-GCCTAGCCATAACAT CTCGAGAG ATA-3¢ ... for 1 min and 72 °C for 1 min, for 35 cycles using HF Taq DNA polymerase (Roche Applied Science, Monza, Italy). For bcp3, the forward primer 5¢-AAATT CA TATGAACGTAGGAGAAGAAGCACCAG-3¢ and the re...

Ngày tải lên: 07/03/2014, 05:20

... persistence and spread of Russian gaps via a multi-agent model with Bayesian learning. We ran three simulations: no grammar learning, learning with arbitrary analogical pressure, and morphophonologically ... development of Russian gaps. 2 The historical and distributional facts of Russian verbal gaps 2.1 Traditional descriptions Grammars and dictionaries of Russian frequ...

Ngày tải lên: 17/03/2014, 04:20

... Satoh K, Mutoh H, Eda A, Yanaka I, Osawa H, Honda S, Kawata H, Kihira K & Sugano K (2002) Aberrant expression of CDX2 in the gastric mucosa with and without intestinal metaplasia: effect of ... (CCCGCGGCTATAAAAGGCCGGGGTGGGG) containing the TATAAA sequence in the Cdx1 promoter was incubated with nuclear extracts from AGS cells and separated on a 5% polyacrylamide gel (lane 2). S...

Ngày tải lên: 23/03/2014, 04:20

... Pept Protein Res 48, 357–363. 39 Masuda M, Nakashima H, Ueda T, Naba H, Ikoma R, Otaka A, Terakawa Y, Tamamura H, Ibuka T, Mura- kami T et al. (1992) A novel anti-HIV synthetic peptide, T-22 ([Tyr5,12,Lys7]-polyphemusin ... 442–450. 13 Clay MA, Anantharamaiah GM, Mistry MJ, Balasubramaniam A & Harmony JA (1995) Locali- zation of a domain in apolipoprotein E with both cytostatic...

Ngày tải lên: 30/03/2014, 03:20

... the head disclosing a 1.4 × 1.3 cm pituitary adenoma, cervical ultrasound and Tc99 m Sestamibi-scans both disclosing hyperplasia of the parathyroid glands, abdom- inal MRI scan and endoscopic ultrasound ... Rodríguez-Espinosa J, Blanco-Vaca F, Matías-Guiu X, de Leiva A, Mauricio D: Genetic, clinical, and biochemical analysis of unrelated Spanish families with multiple endocrine neopl...

Ngày tải lên: 09/08/2014, 01:24

... gonads are at increased risk of malignant transformation [4]. We report a case of yolk sac tumor in the ectopic testis of a patient with TTE. Case Presentation A 24-year-old man, who had fathered ... revealed testicular yolk sac tumor of the ectopic testis. An enlarging left inguinal-mass appeared 2 months ago and he was referred to our hospital. Laboratory data showed an elev...

Ngày tải lên: 09/08/2014, 02:20