Báo cáo toán học: "Evaluations of k-fold Euler/Zagier sums: a compendium of results for arbitrary k" ppsx
Báo cáo toán học: " On the first- and second-order statistics of the capacity " ppt
... properties of the instantaneous capacity
c
of N∗Nakagami-m
channels are analyzed. For example, we have derived exact analytical expressions for the
PDF, CDF, LCR, and ADF of the channel capacity. ... some mathematical manipulations, it can be shown that the obtained results for
the statistical properties of the capacity of N∗Nakagami-m channels reduce to the special
cases o...
Báo cáo toán học: " Weak compactness and the Eisenfeld-Lakshmikantham measure of nonconvexity" potx
...
Weak compactness and the
Eisenfeld–Lakshmikantham measure of
nonconvexity
Isabel Marrero
Departamento de An´alisis Matem´atico, Universidad de La Laguna,
38271 La Laguna, Tenerife, Spain
Email ... Eisenfeld–Lakshmikantham measure of nonconvexity
(E-L measure of nonconvexity, for short) of a bounded subset A of X is
defined by
µ (A) = sup
x∈coA
inf
a A
x − a = H (A, coA),...
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
...
22. Orlacchio A, Gaudiello F, Totaro A, et al. A new SPG4 mutation
in a variant form of spastic paraplegia with congenital arach-
noid cysts. Neurology.2004; 62: 1875-8.
23. Wang P, Liang X, ... Minamitani M, Tanaka J, Hasumura M, et al. Cerebral malfor-
mations associated with probable intrauterine infection. No To
Hattatsu. 1993; 25: 359-63.
17. Singleton WG, Lawrence T, Green...
Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx
... intra-
cellular metabolites. An approach that combines flux
balance analysis (FBA) with an ordinary differential
equation (o.d.e.) model of the slow time scales is called
dynamic flux balance analysis (dFBA), ... windows. The analysis of the mutant
strains clearly showed that a large experimental effort
is necessary for the rational design of bacterial strains
based on mathematical mo...
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx
... this strain
and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine
reports on the chorismate mutase activity ... overall reaction [50].
A rationally designed variant of
L
-Ala-
D
/
L
-Glu epimerase
(a third member of the enolase superfamily, Fig. 8),
containing a mutation (D297G) analogou...
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... repeat amplification were:
1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT
A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC
ATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATT
Table 1. Primers and probe sets used for ... CGCTTTCGGAGGTGCTTTCGCAG
M1941p65.R: TCAGAGTTCCCTACCGAAGCAG
P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA
M225PO.P: CCGTGGTGCTGATGGGCAAGAA
M267PO.R: ACCATGATGCGCAAGGC...
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx
... the ERK1 ⁄ 2 pathway, the PKB pathway and the
Janus kinase ⁄ signal transducer and activator of tran-
scription (JAK-STAT) pathway, to promote prolifera-
tion, survival and transformation [56,57]. ... 854–864.
62 Kuribara R, Honda H, Matsui H, Shinjyo T, Inukai T,
Sugita K, Nakazawa S, Hirai H, Ozawa K & Inaba T
(2009) Roles of Bim in apoptosis of normal and
Bcr-Abl-expressing hemat...
Báo cáo sinh học: "An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" pptx
... will aid
in assessing the translational potential of ideas that are
still in the percolation phase.
The NIH intramural program is an ideal test site for
such new translational research approaches, ... with the goal of producing a cadre of researchers
who can translate laborator
y
and clinical advances into public bene
f
it
Figure 1 Elements of an NIH intramural percubator progr...