Báo cáo toán học: "Evaluations of k-fold Euler/Zagier sums: a compendium of results for arbitrary k" ppsx

... properties of the instantaneous capacity c of N∗Nakagami-m channels are analyzed. For example, we have derived exact analytical expressions for the PDF, CDF, LCR, and ADF of the channel capacity. ... some mathematical manipulations, it can be shown that the obtained results for the statistical properties of the capacity of N∗Nakagami-m channels reduce to the special cases o...

Ngày tải lên: 20/06/2014, 20:20

...  Weak compactness and the Eisenfeld–Lakshmikantham measure of nonconvexity Isabel Marrero Departamento de An´alisis Matem´atico, Universidad de La Laguna, 38271 La Laguna, Tenerife, Spain Email ... Eisenfeld–Lakshmikantham measure of nonconvexity (E-L measure of nonconvexity, for short) of a bounded subset A of X is defined by µ (A) = sup x∈coA inf a A x − a = H (A, coA),...

Ngày tải lên: 20/06/2014, 20:20

...

Ngày tải lên: 05/08/2014, 10:20

...

Ngày tải lên: 05/08/2014, 15:20

... 22. Orlacchio A, Gaudiello F, Totaro A, et al. A new SPG4 mutation in a variant form of spastic paraplegia with congenital arach- noid cysts. Neurology.2004; 62: 1875-8. 23. Wang P, Liang X, ... Minamitani M, Tanaka J, Hasumura M, et al. Cerebral malfor- mations associated with probable intrauterine infection. No To Hattatsu. 1993; 25: 359-63. 17. Singleton WG, Lawrence T, Green...

Ngày tải lên: 25/10/2012, 11:00

... intra- cellular metabolites. An approach that combines flux balance analysis (FBA) with an ordinary differential equation (o.d.e.) model of the slow time scales is called dynamic flux balance analysis (dFBA), ... windows. The analysis of the mutant strains clearly showed that a large experimental effort is necessary for the rational design of bacterial strains based on mathematical mo...

Ngày tải lên: 18/02/2014, 13:20

... this strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine reports on the chorismate mutase activity ... overall reaction [50]. A rationally designed variant of L -Ala- D / L -Glu epimerase (a third member of the enolase superfamily, Fig. 8), containing a mutation (D297G) analogou...

Ngày tải lên: 19/02/2014, 12:20

... repeat amplification were: 1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC ATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATT Table 1. Primers and probe sets used for ... CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGC...

Ngày tải lên: 07/03/2014, 03:20

... the ERK1 ⁄ 2 pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of tran- scription (JAK-STAT) pathway, to promote prolifera- tion, survival and transformation [56,57]. ... 854–864. 62 Kuribara R, Honda H, Matsui H, Shinjyo T, Inukai T, Sugita K, Nakazawa S, Hirai H, Ozawa K & Inaba T (2009) Roles of Bim in apoptosis of normal and Bcr-Abl-expressing hemat...

Ngày tải lên: 16/03/2014, 00:20

... will aid in assessing the translational potential of ideas that are still in the percolation phase. The NIH intramural program is an ideal test site for such new translational research approaches, ... with the goal of producing a cadre of researchers who can translate laborator y and clinical advances into public bene f it Figure 1 Elements of an NIH intramural percubator progr...

Ngày tải lên: 18/06/2014, 19:20