Báo cáo sinh học: " Sperm dumping as a defense against meiotic drive" doc

Báo cáo sinh học: " Sperm dumping as a defense against meiotic drive" doc

Báo cáo sinh học: " Sperm dumping as a defense against meiotic drive" doc

... organ are potentially damaging to sperm, and large ejaculates may be better able to buffer against female spermicide and hence survive longer. Certainly the uterus of a female Drosophila is a ... ‘driving’ sperm was preferentially discarded by females. The authors confirmed that this effect was not simply due to a higher death rate of SR sperm in storage by assaying sperm morta...

Ngày tải lên: 06/08/2014, 18:21

3 300 0
Báo cáo khoa học: "TAG''''s as a Grammatical Formalism for Ceneration" doc

Báo cáo khoa học: "TAG''''s as a Grammatical Formalism for Ceneration" doc

... Grammars, or "TAG's', (Josh/, Levy & Takahash/ 1975; Josh/ 1983; Kroch & Josh/ 1965) we~ developed as an al~ma~ive to the aandard tyntac~ formalisms that are ,,_~'~ ... orientation makes systemic grammars more immediately useful than, for example, tramffotmationai generatb,+ grammars or even procedurally oriented AI fogmali-qa~s |of language such as...

Ngày tải lên: 24/03/2014, 02:20

10 505 0
Báo cáo hóa học: " Bilateral hemotympanum as a result of spontaneous epistaxis" doc

Báo cáo hóa học: " Bilateral hemotympanum as a result of spontaneous epistaxis" doc

... hemotympanum [8-10]. It is most often associated with temporal traumas rather than nasal packing [1], but occasionally nasal packing, which can lead to peritubal lymphatic stasis, is a cause of ... cited. foreignbodiesinthenasalpassage, topical sprays or dust, inflammatory nasal diseases, septal deformities, tumors and vascular a neurysms can be the local factors [5,6]. Coagulation defici...

Ngày tải lên: 21/06/2014, 07:20

3 334 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

... S, Asano N & Suzuki Y (1999) Acceler- ated transport and maturation of lysosomal alpha-galac- tosidase A in Fabry lymphoblasts by an enzyme inhibitor. Nat Med 5, 112–115. 20 Fan J-Q & ... cardiac function in the cardiac variant of Fabry’s disease with galactose-infusion therapy. N Engl J Med 345, 25–32. 18 Asano N, Ishii S, Kizu H, Ikeda K, Yasuda K, Kato A, Martin OR & Fan .....

Ngày tải lên: 18/02/2014, 16:20

7 507 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... stabilities. Remarkably, we have found that, at least in some circumstances, a quanti- tative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations ... the association of the variable heavy chain (V H )with protein A was used as a surrogate for direct stability measurements. The V H domains in camelid heavy chain antibodies are mos...

Ngày tải lên: 19/02/2014, 12:20

7 502 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... L. lactis ald gene as follows. A PCR fragment was generated using primer CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified. The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, resp...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx

Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx

... planning specification language and show how LTAG grammaticality can be encoded as a PDDL problem and how we can reconstruct an LTAG derivation from the plan. 2.1 Tree-adjoining grammars The grammar ... ground atoms of predicate logic that are true in this state; all other atoms are as- sumed to be false. Actions have a number of param- eters, as well as a precondition and effect...

Ngày tải lên: 20/02/2014, 12:20

8 339 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... discriminant analysis (LDA).Thisstatistical multivariate method is supervised. It searches for the variables containing the greatest interclass variance and the smallest intraclass variance, and constructs ... Many parameters can be adjusted for increasing the efficiency of the algorithm. The data were analysed with a window of five wavenumbers, assuming that adjacent wavenumbers are highly c...

Ngày tải lên: 21/02/2014, 03:20

6 555 0
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

... Isolation of a bound peptide. Nucleic Acids Res. 20, 3241–3248. 12. Wyszynski, M.W., Gabbara, S., Kubareva, E .A. , Romanova, E .A. , Oretskaya, T.S., Gromova, E.S., Shabarova, Z .A. & Bhagwat, A. S. (1993) ... 2004 2-Pyrimidinone as a probe for studying the Eco RII DNA methyltransferase–substrate interaction Oksana M. Subach 1 , Anton V. Khoroshaev 1 , Dmitrii N. Gerasimov 1 , Vla...

Ngày tải lên: 07/03/2014, 15:20

9 437 0
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

... h; Asp255His, 4.5 h; Pro136Leu, 8 h). After the chase ASA was immunoprecipitated from the homogenates with the polyclonal ASA antiserum. Precipi- tated ASA was quantified after SDS ⁄ PAGE with a ... Acceler- ated transport and maturation of lysosomal alpha-galac- tosidase A in Fabry lymphoblasts by an enzyme inhibitor. Nat Med 5, 112–115. 14 Schierau A, Dietz F, Lange H, Schestag F, Paras...

Ngày tải lên: 07/03/2014, 17:20

10 505 0
w