Báo cáo sinh học: "Comprehensive curation and analysis of global interaction networks in Saccharomyces cerevisiae" doc
Báo cáo sinh học: " Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" potx
... problems
relating to sensitivity of the HSV-1 and -2 probe relative
binding. In a single step multiplex assay mutations in the
probe binding area are reported to lead to a loss in sensi-
tivity and error in ... effec-
tiveness of any current intervention, determining the effi-
cacy of drugs, assessing drug resistance and are useful
research tools in the study of the ep...
báo cáo sinh học:" Job satisfaction and motivation of health workers in public and private sectors: cross-sectional analysis from two Indian states" ppt
... lists of public and private
facilities in e ach district, using a random starting point
and fixed selection interval. Doctors and nurses were
selected at random from a list of all doctors and nurses
usually ... [15]. The
Joint Learning Initiative Report also highlights the
importance of management culture and working condi-
tions in affecting motivation, and cites small...
báo cáo hóa học:" Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China" doc
... developed
thickening and peeling of the skin at medial and lateral
sides of both hands and feet at 1 year of age. Pure-tone
audiometry testing showed that her father had moderate
high-frequency hearing loss, ... function and structure of the thyroid
instead of perchlorate discharge testing, a routine method
used for examining thyroid function that is not available
in most...
báo cáo sinh học:" The training and expectations of medical students in Mozambique" doc
... the
private for profit sector and 21% the private not for profit
sector.
Of 186 students who preferred the public sector, 36%
indicated the intention of combining a public sector job
with work in the private ... exam-
ple, growing up in rural communities increases the prob-
ability of practising in rural areas [6]; female medical
doctors are less prone to accept rural posts; an...
báo cáo sinh học:" Appropriate training and retention of community doctors in rural areas: a case study from Mali" pdf
... other incentives and support mechanisms (follow up
visits, continuing training, mentoring ) affecting job satisfaction.
Conclusion: Training increasing self confidence and self esteem of rural ... implications
As the training consists to a large extent in compensating
for shortcomings of the medical school-based training, a
reasonable approach would be to incorporate this kind of...
báo cáo sinh học:" The distribution and transitions of physicians in Japan: a 1974–2004 retrospective cohort study" pot
... surgery.
Possible impact of changes in initial clinical training system
Japan introduced a new clinical training system in 2004,
and this will probably affect physicians' career choices in
the future. ... working in high-risk spe-
cialties are less satisfied [13,14] and more inclined to
change jobs [15].
In Japan, HPs' working conditions, in terms of working
hour...
Báo cáo sinh học: " Tumor escape and progression of HER-2/neu negative breast cancer under immune pressure" potx
... view of the role of IFN-g
producing T cells in protecting the host against cancers.
For example, IFN-g was shown to promote immune
editing and subsequent tumor escape in the CT26 colon
carcinoma ... AAACTCGAGAAGCGACGGCAGCAGAAG
AT 3’ and reverse: 5’ CTT AAG CTT TCA CAC TGG
CAC GTC CAG 3’ . The orientation and integrity of
inserted sequence were screened by detailed restriction...
Báo cáo sinh học: " Context-aware visual analysis of elderly activity in cluttered home environment" doc
... the sequences in the dataset were randomly allocated to training
and testing such that half of the examples were allocated for testing. The
training and test sets were then swapped, and results ... St-Arnaud, J Rousseau, in Proceedings of 28th
Annual International Conference of the IEEE Engineering in Medicine and
Biology Society. Monocular 3d Head Tracking to Detect Falls...
Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc
... relating
to low potency and cost. Peptide-based drug candidates
are limited by insufficient efficacy and unfavorable phar-
macokinetics. MAbs have increasingly gained favor in
large part because of ... target-
ing mRNA for degradation and indirectly inhibiting all viral
RNA transcription. Proc Natl Acad Sci USA 2003, 100:2718-2723.
45. Gitlin L, Karelsky S, Andino R: Short interferi...
Tài liệu Báo cáo Y học: Structural diversity and transcription of class III peroxidases from Arabidopsis thaliana docx
... an
invariantpartofallthreeclassesoftheplantperoxidase
superfamily [44]. This motif (shown in grey shading in
Fig. 1) includes Ser96 and Asp99 located at the beginning
of helix D and connecting ... numbers and names in Table 1;
protein similarity in Fig. 1). The genes for AtP38 and
At4g08780 are also in tandem, however, in inverted
orientation. The two E-types of genes...