... problems relating to sensitivity of the HSV-1 and -2 probe relative binding. In a single step multiplex assay mutations in the probe binding area are reported to lead to a loss in sensi- tivity and error in ... effec- tiveness of any current intervention, determining the effi- cacy of drugs, assessing drug resistance and are useful research tools in the study of the ep...
Ngày tải lên: 19/06/2014, 08:20
... lists of public and private facilities in e ach district, using a random starting point and fixed selection interval. Doctors and nurses were selected at random from a list of all doctors and nurses usually ... [15]. The Joint Learning Initiative Report also highlights the importance of management culture and working condi- tions in affecting motivation, and cites small...
Ngày tải lên: 18/06/2014, 17:20
báo cáo hóa học:" Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China" doc
... developed thickening and peeling of the skin at medial and lateral sides of both hands and feet at 1 year of age. Pure-tone audiometry testing showed that her father had moderate high-frequency hearing loss, ... function and structure of the thyroid instead of perchlorate discharge testing, a routine method used for examining thyroid function that is not available in most...
Ngày tải lên: 18/06/2014, 15:20
báo cáo sinh học:" The training and expectations of medical students in Mozambique" doc
... the private for profit sector and 21% the private not for profit sector. Of 186 students who preferred the public sector, 36% indicated the intention of combining a public sector job with work in the private ... exam- ple, growing up in rural communities increases the prob- ability of practising in rural areas [6]; female medical doctors are less prone to accept rural posts; an...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Appropriate training and retention of community doctors in rural areas: a case study from Mali" pdf
... other incentives and support mechanisms (follow up visits, continuing training, mentoring ) affecting job satisfaction. Conclusion: Training increasing self confidence and self esteem of rural ... implications As the training consists to a large extent in compensating for shortcomings of the medical school-based training, a reasonable approach would be to incorporate this kind of...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" The distribution and transitions of physicians in Japan: a 1974–2004 retrospective cohort study" pot
... surgery. Possible impact of changes in initial clinical training system Japan introduced a new clinical training system in 2004, and this will probably affect physicians' career choices in the future. ... working in high-risk spe- cialties are less satisfied [13,14] and more inclined to change jobs [15]. In Japan, HPs' working conditions, in terms of working hour...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Tumor escape and progression of HER-2/neu negative breast cancer under immune pressure" potx
... view of the role of IFN-g producing T cells in protecting the host against cancers. For example, IFN-g was shown to promote immune editing and subsequent tumor escape in the CT26 colon carcinoma ... AAACTCGAGAAGCGACGGCAGCAGAAG AT 3’ and reverse: 5’ CTT AAG CTT TCA CAC TGG CAC GTC CAG 3’ . The orientation and integrity of inserted sequence were screened by detailed restriction...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: " Context-aware visual analysis of elderly activity in cluttered home environment" doc
... the sequences in the dataset were randomly allocated to training and testing such that half of the examples were allocated for testing. The training and test sets were then swapped, and results ... St-Arnaud, J Rousseau, in Proceedings of 28th Annual International Conference of the IEEE Engineering in Medicine and Biology Society. Monocular 3d Head Tracking to Detect Falls...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc
... relating to low potency and cost. Peptide-based drug candidates are limited by insufficient efficacy and unfavorable phar- macokinetics. MAbs have increasingly gained favor in large part because of ... target- ing mRNA for degradation and indirectly inhibiting all viral RNA transcription. Proc Natl Acad Sci USA 2003, 100:2718-2723. 45. Gitlin L, Karelsky S, Andino R: Short interferi...
Ngày tải lên: 18/06/2014, 22:20
Tài liệu Báo cáo Y học: Structural diversity and transcription of class III peroxidases from Arabidopsis thaliana docx
... an invariantpartofallthreeclassesoftheplantperoxidase superfamily [44]. This motif (shown in grey shading in Fig. 1) includes Ser96 and Asp99 located at the beginning of helix D and connecting ... numbers and names in Table 1; protein similarity in Fig. 1). The genes for AtP38 and At4g08780 are also in tandem, however, in inverted orientation. The two E-types of genes...
Ngày tải lên: 21/02/2014, 01:21