Báo cáo sinh học: " Systematic identification of regulatory proteins critical for T -cell activation" doc

Báo cáo sinh học: " Systematic identification of regulatory proteins critical for T -cell activation" doc

Báo cáo sinh học: " Systematic identification of regulatory proteins critical for T -cell activation" doc

... enrichment in the first round of sorting. In subsequent rounds of sorting, the sorting gate R2 was always maintained to capture the equiv- alent of 1% of the control cells that were stimulated but were ... CD69 level without Dox and the solid line with Dox (bottom graph). Research article Systematic identification of regulatory proteins critical for T- cell activation P...

Ngày tải lên: 06/08/2014, 18:20

16 316 0
báo cáo sinh học:" Systematic inclusion of mandatory interprofessional education in health professions curricula at Gunma University: a report of student self-assessment in a nine-year implementation" ppt

báo cáo sinh học:" Systematic inclusion of mandatory interprofessional education in health professions curricula at Gunma University: a report of student self-assessment in a nine-year implementation" ppt

... 2.93). It is noteworthy that in addition to this Q6, in five other items OT students also showed lower points as compared with other department students. The mean scores of OT department students for ... reported in OT students. This may be due to unique factor(s) in the introduction of IPE into OT student education; for example, a competitive profes- sional situation (the rivalry amo...

Ngày tải lên: 18/06/2014, 17:20

8 488 0
báo cáo sinh học:" An experience of virtual leadership development for human resource managers" ppt

báo cáo sinh học:" An experience of virtual leadership development for human resource managers" ppt

... data about staff attrition. The study data will be used to develop retention strategies. The respondent reported that the team held the workshop, developed a survey and is collecting data. In July ... demonstrated the critical role that effective leadership plays in transforming HR strategies into results on the ground. It is essential that groups like the Global Health Workforce Alliance a...

Ngày tải lên: 18/06/2014, 17:20

3 327 0
Báo cáo sinh học: " Intracellular localization of Crimean-Congo Hemorrhagic Fever (CCHF) virus glycoproteins" docx

Báo cáo sinh học: " Intracellular localization of Crimean-Congo Hemorrhagic Fever (CCHF) virus glycoproteins" docx

... (RF372/RF373: GATCCTTTGGCTATGT AATAACCTGCATACTTTGCAAGGCCATTTTTTACTTGT- TAATAATTGTTGGATAAT/ CTAGATTATCCAACAATTATTAACAAGTAAAAAATGGCC TTGCAAAGTATGCAGGTTATTACATAGCCAAAG). The expression of the resulting constructs GFP-G N A, GFP-G N B, GFP-G N C, ... (AGTTGGTCTAGCCAATGT- GTG) and RF351 (AATCGTCTCAAATTCATGGAGAC AGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTC CAGGTTCCACTGGTGACTTCCTAGATAGTA- CAGCTAAAGGCATG...

Ngày tải lên: 19/06/2014, 08:20

14 294 0
Báo cáo sinh học: "Adaptive evolution of centromere proteins in plants and animals" ppt

Báo cáo sinh học: "Adaptive evolution of centromere proteins in plants and animals" ppt

... amplified with the primers 5´-AGATAAGCCAATCCATACATCA-3´ and 5´-CCCCTCTTTTCATTCTCTTCAA-3´. The first and last of these four primers were also used to amplify both exon pairs as a unit to confirm their ... 18 Talbert et al. http://jbiol.com/content/3/4/18 Journal of Biology 2004, 3:18 these cDNAs were amplified using the same primers: 5´-GGAATTTTCCGGTGATTTAGATG-3´, which terminates in the i...

Ngày tải lên: 06/08/2014, 18:21

17 385 0
Báo cáo khoa học: "The utility of parse-derived features for automatic discourse segmentation" doc

Báo cáo khoa học: "The utility of parse-derived features for automatic discourse segmentation" doc

... the utility of these approximations of the SPADE-like context-free features. The performance of the resulting “Full” finite-state system is not sta- tistically significantly different from that of ... parse for that document. Therefore, to perform accurate and efficient pars- ing of the RST-DT at the paragraph level, the text should be segmented into paragraph-like segments that conf...

Ngày tải lên: 08/03/2014, 02:21

8 373 0
Báo cáo khoa học: "A Suite of Shallow Processing Tools for Portuguese: LX-Suite" doc

Báo cáo khoa học: "A Suite of Shallow Processing Tools for Portuguese: LX-Suite" doc

... not immediately tokenized. Instead, the decision counts on the contribution of the POS tagger: The tagger must fi rst be trained on a version of the corpus where the ambiguous strings are not tokenized, ... test runs over different 10% contiguous portions of the corpus that were not used for training. The POS tagger we developed is currently the fastest tagger for the Portuguese lang...

Ngày tải lên: 17/03/2014, 22:20

4 270 0
Báo cáo khoa học: Molecular characterization of secretory proteins Rv3619c and Rv3620c fromMycobacterium tuberculosisH37Rv docx

Báo cáo khoa học: Molecular characterization of secretory proteins Rv3619c and Rv3620c fromMycobacterium tuberculosisH37Rv docx

... on mixing of the two proteins at pH 4.5, the resultant spectra, shown in Fig. 3B, dem- onstrated significant loss of structure. This could be attributable to weak interactions between two unfolded or ... skimmed milk. After the usual steps washing steps, the 50-lL supernatant of spleenocytes cultured for 48 h were used for detection of cytokines. After the stipulated incubation t...

Ngày tải lên: 22/03/2014, 16:21

13 280 0
Báo cáo sinh học: "Q&A: What can microfluidics do for stem-cell research" ppsx

Báo cáo sinh học: "Q&A: What can microfluidics do for stem-cell research" ppsx

... to define the limits of physical, mechanical and biochemical factors that are tolerated by stem cells at different stages of differentiation. What have been the important contributions of microfluidics ... Whitesides points out that one of the best developed applications of microfluidics is in protein crystallographic studies, to screen the conditions that encourage growth and prot...

Ngày tải lên: 06/08/2014, 19:21

3 294 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... HSV1 GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC VZV GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT HHV6 GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT CMV GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCT...

Ngày tải lên: 18/06/2014, 22:20

24 605 0
w