... senior and qualified staff from the European Union at a local salary that is topped up by CIM. Not a typical actor in the frame of development cooperation, the German Academic Exchange Service (DAAD) ... complexity of addressing HRH, the examples above illustrate that development partners can play differ- ent roles according to their comparative advantage. The poten...
Ngày tải lên: 18/06/2014, 17:20
... for Health Open Access Research Employment and sociodemographic characteristics: a study of increasing precarity in the health districts of Belo Horizonte, Brazil Maria Cristina Ramos de Vasconcellos ... competing interests. Authors' contributions MC, AA and SB jointly formulated the study design. MC obtained the data. MC and AA were involved...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" “More money for health - more health for the money”: a human resources for health perspective" pdf
... Workforce Alliance: The Kampala Declaration and Agenda for Global Action. Geneva, Switzerland: Global Health Workforce Alliance; 2008 [http://www.who.int/workforcealliance/Kampala%20Declaration%20and %20Agenda%20web%20file.%20FINAL .pdf] . 6. ... man agement Campbell et al. Human Resources for Health 2011, 9:18 http://www .human- resources -health. com/content/9/1/18 Page 4 of...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Porcine adenovirus type 3 E1Blarge protein downregulates the induction of IL-8" doc
... of porcine adenovirus type 3. Virology 1998, 251:414-426. 19. Zakhartchouk A, Zhou Y, Tikoo SK: A recombinant E1-deleted porcine adenovirus- 3 as an expression vector. Virology 20 03, 31 3 :37 7 -38 6. 20. ... regulate the transcription of some chemokines [7, 23] . To determine the effect of PAdV -3 E1 proteins on the induction of chemokines, HeLa cells were infe...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Selection of Recombinant MVA by Rescue of the Essential D4R Gene" doc
... generation of recombinant MVA [43,44]. While the BAC technology offers the advantage of targeting any genomic locus of MVA, the method is dependent on the use of a helper virus, and results in recombinants ... detected in the dMVA-ZG stock confirming therefore the purity of the defective virus. Figure 4 PCR analysis of the D4R deletion in the defective...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Comparison between 68Ga-bombesin (68Ga-BZH3) and the cRGD tetramer 68Ga-RGD4 studies in an experimental nude rat model with a neuroendocrine pancreatic tumor cell line" ppt
... be made available soon. Comparison between 68Ga-bombesin (68Ga-BZH3) and the cRGD tetramer 68Ga-RGD4 studies in an experimental nude rat model with a neuroendocrine pancreatic tumor cell line EJNMMI ... assess tissue viability, thereby gain the staging and therapy monitoring by qualitative analysis of SUV and quantitative evaluation based on...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " PET kinetics of radiolabeled antidepressant, [N-methyl-11C]mirtazapine, in the human brain" ppt
... use in PET imaging for obtaining estimates of pharmacokinetic parameters, such as the binding potentials of [N-methyl- 11 C]mirtazapine in regions of the living human brain. Since that method ... [N-methyl- 11 C]mirtazapine can provide insight into antidepressant actions that cannot otherwise be studied in the living human brain. Competing interests The authors...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC VZV GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT HHV6 GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT CMV GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC ... GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCA...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf
... UV-light. Nucleotide mismatches in the primersFigure 2 Nucleotide mismatches in the primers. The target sequence is the VP7 gene of G1 Bangladeshi strains. The G1 rotavirus VP7 gene specific primers ... 1 of 5 (page number not for citation purposes) Virology Journal Open Access Research Typing of human rotaviruses: Nucleotide mismatches between the...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo sinh học: " International Committee on Taxonomy of Viruses and the 3,142 unassigned species" docx
... Denis.Fargette@mpl.ird.fr * Corresponding author Abstract In 2005, ICTV (International Committee on Taxonomy of Viruses) , the official body of the Virology Division of the International Union of Microbiological ... Journal Open Access Commentary International Committee on Taxonomy of Viruses and the 3,142 unassigned species CM Fauquet* 1 and D...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo sinh học: " Research Article On an Inverse Scattering Problem for a Discontinuous Sturm-Liouville Equation with a Spectral Parameter in the Boundary Condition'''' pptx
... Spectral analysis of the problem on the half-line was studied by Fulton 22. Also, physical application of the problem with the linear spectral parameter appearing in the boundary conditions on the ... Section 2, the scattering data for the boundary value problem 1.1–1.3 are defined. In Section 3, the fundamental equation for the inve...
Ngày tải lên: 21/06/2014, 16:20
Báo cáo sinh học: "The Drosophila Forkhead transcription factor FOXO mediates the reduction in cell number associated with reduced insulin signaling" potx
... a reduction in cell number but not in cell size in response to reduced insulin signaling. dFOXO controls the reduction in cell number in body-size mutants Genetic analysis of the control of body size in ... conditions of impaired insulin sig- naling. The pathway controlling body size in response to insulin therefore bifurcates at the level of dPKB:...
Ngày tải lên: 06/08/2014, 18:20
báo cáo khoa học: "SND2, a NAC transcription factor gene, regulates genes involved in secondary cell wall development in Arabidopsis fibres and increases fibre cell area in Eucalyptus" doc
... Change in fibre SCW thickness, cell wall area, fibre cell area and lumen area of Eucalyptus sectors overexpressing Arabidopsis SND2. Sample Cell wall thickness (%) Cell wall area (%) Fibre ... ANAC019 (Arabidopsis NAC domain containing protein 19); transcription factor 1.44 3.07E-04 AT1G32770 ANAC012/NST3/SND1 (ARABIDOPSIS NAC DOMAIN CONTAINING...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo sinh học: "PhyloScan: identification of transcription factor binding sites using cross-species evidence" ppsx
... the binding of transcription factors (proteins) to cognate sites on a chromosome (tran- scription factor binding sites) . For a given transcription factor and an experimentally identified set of ... for transcription factor binding sites is reduced. A search of such a reduced database in and of itself will allow the detection of more statistically significant...
Ngày tải lên: 12/08/2014, 17:20
Báo cáo sinh học: " Molecular cloning and partial sequence characterization of the duplicated amylase genes from Drosophila erecta" pps
... (Hickey et al, 1990). Original article Molecular cloning and partial sequence characterization of the duplicated amylase genes from Drosophila erecta L Bally-Cuif, V Payant, S ... between the 2 copies of the gene within a locus. We cloned both copies of the amylase gene from D erecta and sequenced part of the coding region...
Ngày tải lên: 14/08/2014, 20:20