Level A lesson 43Posted in January 14 pptx
Level A lesson 43Posted in January 14 pptx
... in the cup. B A. some B. any C. many D. much B A. some B. any C. many D. much 7. There is ………… milk in the glass. A A. some B. any C. many D. much Level A lesson 43 Posted in January ... on the table. A A. some B. any C. many D. much 4. Is there ………. cheese on the table? B A. some 10. They want …………… coffee, but they don’t want any bread. A A. some B. any C. many D. ... D. they 14. He is …………… engineer. A A. an B. a C. the D. no article 15. Your sister is a student and his sister is a student, ……………. D A. both B. her C. hers D. his 3. There are ………....
- 9
- 328
- 0
Level A lesson 53 pptx
... 53 1. His promotion to manager was a popular ………………………………. C A. appoint B. appointed C. appointment D. appointee 2. A holiday in America can be ………………… cheap. D A. surprise B. surprised ... dust. A A. contaminated B. contaminate C. contamination D. contaminating 7. The heavily ………………. atmosphere in some industrial regions is called “smog”, a word derived from “smoke” and “fog”. ... way he behaves. It was quite out of character. C A. about B. with C. at D. B & C are correct 6. The air is naturally …………………. by foreign matter such as plant pollens and dust. A A....
- 9
- 414
- 1
Level A lesson 28 pptx
... students (D) Almost the students 20. He went to bed with ________ bad cold. A (A) a (B) an (C) the (D) an Level A lesson 28 Posted in January 14th, 2009 by admin in English Test Level A 1. ... ________ May 17. A (A) on (B) at (C) in (D) zero 18. The picture was ________ in the museum. A (A) hung (B) hang (C) hanged (D) hanging 19. ________ study hard before an examination. C (A) ... want a certificate ________ have to pass the final examination. B (A) she (B) they (C) you (D) their 11. They forced us ________ their invitation. D (A) accept (B) accepting 6. John and...
- 12
- 315
- 0
Level A lesson 18 pptx
... 14. You had beter ________ harder. A (A) work B (A) Did (B) Was (C) Had (D) Have Level A lesson 18 Posted in January 14th, 2009 by admin in English Test Level A 1. He’s ________ intelligent ... quickly. (B) always leave half an hour early (C) leave always half an hour early (D) leave always early half an hour 3. ________ of my friends can speak French very well. D (A) No one (B) ... intelligent than his sister. B (A) lesser (B) much less (C) much fewer (D) not so 2. I ________. B (A) always leave early half an hour (B) make (C) making (D) made 7. This man has dark ________....
- 11
- 288
- 0
Level A lesson 17 pptx
... Posted in January 14th, 2009 by admin in English Test Level A 1. Since the beginning of the storm several trees ________ down. C (A) fell (B) felt (C) have fallen (D) have felt 2. Can you ... B (A) to speak (B) speak (C) speaks (D) speaking 3. I have a sister but ________ brothers. A (A) no (B) any (C) some (D) none 4. Tell me, are ________ letters for me? A (A) those ... ________ French? D (A) myself the hat (B) me the hat (C) the my hat (D) my hat 11. Janet and I live quite near ________ each other. B (A) from (B) - (C) at (D) as 12. She can hardly see it....
- 11
- 347
- 0
Level A lesson 14 ppsx
... eleven players. B (A) composes (B) is composed Level A lesson 14 Posted in January 14th, 2009 by admin in English Test Level A 1. “________ good news to me” said Tom. D (A) There are (B) ... Eistein’s theories were officially declared ________ because they had been formulated by a Jew. A (A) false (B) falsely D (A) in (B) from (C) on (D) of 3. - There’s a buffalo in the garden! ... surrouding area. C (A) suit (B) fit (C) blend (C) being false (D) as false 10. I saw him ________ dead by the soldier. D (A) shooting (B) shoot (C) to shoot (D) shot 11. A football team...
- 12
- 348
- 0
Level A lesson 9 pptx
... 14. It’s a lovely day, but I ________ staying at home with you. A (A) don’t mind (B) haven’t mind (C) am not minding (D) wasn’t minding 15. - There are two Olympic medalists entered in ... birthday? A (A) when (B) whose (C) why (D) how’s 9. He took ________ cheese. D (A) all of (B) all (C) the all (D) all of the Level A lesson 9 Posted in January 14th, 2009 by admin in ... ________ ? C (A) winning (B) in winning (C) to win (D) that he win 16. - Who ________ that horrible noise? - It’s Tom practising the violin. C (A) makes (B) made (C) is making 8. ________...
- 12
- 291
- 0
Business English Lesson – Advanced Level''''s archivePayroll policy in the USA pptx
... 5. The rates for overtime in the USA are generally known as pay-plus-one-half an hour and a half hour plus half time-and -a- half 2. pay is what an employee actually receives after deductions. ... checkbook balance but has not yet cleared the bank. intermediate overdue outstanding overdrawn 10. Books are all closed at the end of an accounting period. A more common term for an accounting ... dollars Business English Lesson – Advanced Level& apos;s archive Payroll policy in the USA 1. pay is what an employee earns before deductions. Net Full Gross Complete wage salary 5....
- 8
- 369
- 0
Tài liệu A WINTER TOUR IN SOUTH AFRICA pptx
... I came away quite amazed at all I saw, as well as pleased at the attention I received from the Abbot. He is certainly a very remarkable man, of great natural gifts, and indomitable energy and ... is a pleasant seaside resort for the inhabitants of the colony, the air being regarded as particularly invigorating. The remaining distance of six miles to Simon's Town is performed in a ... Simon's Town was the Dockyard, which embraces about a mile of the foreshore, and contains appliances for repairing modern war vessels, a repairing and victualling depôt, and a patent slip,...
- 92
- 391
- 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
... TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ATTGTTTTCTCTCAAGACCCAATaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG18Sfw CGCCGCTAGAGGTGAAATTC18Srev TCTTGGCAAATGCTTTCGCTTaqMan probe 18S TGGACCGGCGCAAGACGGACABFig. ... kit (Stratagene, La Jolla,CA, USA). Mutagenic primers were: 5¢-CGCTCGAGATGAAAATTGACATCGCTAGTCATATTCTACC-3¢ andits complement for His6Ala; 5¢-GACATCCATAGTGCTATTCTACCAAAAGAATGGCC-3¢ and its ... rev,reverse.SequenceACMSD cloning: primer1fw CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time PCR: primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw...
- 14
- 601
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ