Designation: C 595 – 00ae1 - Standard Specification for Blended Hydraulic Cements1 pps

... percentages of tricalcium silicate, dicalcium silicate, tricalcium aluminate, and tetracal- cium aluminoferrite shall be calculated from the chemical analysis as follows: Tricalcium silicate ~C 3 S!5 ~ 4.071 ... Sulfate C 465 Specification for Processing Additions for Use in the Manufacture of Hydraulic Cements C 563 Test Method for Optimum SO 3 in Hydraulic Cement Using 24-h...

Ngày tải lên: 28/06/2014, 10:20

... front-end namespaces shown below, one for C (Compilers .C) and another for C# (Compilers.Csharp), can own (and access) different classes with the same name. Therefore, Lexer and Parser for the C compiler ... syntactic features of C# are borrowed from C/ C++, and most of its object-oriented concepts, such as garbage collection, reflection, the root class, and the multiple inheri- t...

Ngày tải lên: 20/08/2012, 11:57

... Order, Forwarder’s Certificate of Receipt, Forwarder’s Certificate of Shipment, Forwarder’s Certificate of Transport, Forwarder’s Cargo Receipt and Mate’s Receipt do not reflect a contract of carriage ... international standard banking practice: a) “shipping documents” – all documents (not only transport documents), except drafts, required by the credit. b) “stale documents accepta...

Ngày tải lên: 09/12/2013, 22:15

... message: please call the Document Policy Management Group at 1-8 0 0-4 5 1-1 584. | | | ||| || | | || | | |||| |||| | | || | | COPYRIGHT 2002; International Electrotechnical Commission Document provided ... message: please call the Document Policy Management Group at 1-8 0 0-4 5 1-1 584. | | | ||| || | | || | | |||| |||| | | || | | COPYRIGHT 2002; International Electrotechn...

Ngày tải lên: 25/12/2013, 10:57

... specifications. 2.1 Specification Mining Product specifications can usually be fetched from web sites like Amazon automatically. Those mate- rials have several characteristics that are very help- ful ... features. Clustering algorithm can be used to combine specifications. We propose an approach that takes following in- herent information of specifications into account: • Hierarchy structure: Po...

Ngày tải lên: 20/02/2014, 09:20

... the command. The second character or character pair indicates the speci c type of the arguments: 8-bit integer, 16-bit integer, 32-bit integer, single-precision floating-point, or double-precision ... dereferenced by any GL commands, the mapping must be Version 1.5 - October 30, 2003 Copyright c  199 2-2 003 Silicon Graphics, Inc. This document contains unpublished information of Sil...

Ngày tải lên: 06/03/2014, 20:20

... 5¢-TCCTCCACC CAGCGGCGACGCTTACCGCCCGAGTCGATCTTGG GGT-3¢ were used as forward and reverse primers, respec- tively. For construction of the Tr(delDSGL 559 ) mutant, the forward primer 5¢-CGAATCCCTACCCCAAGATCTGAT CGGGCCTGAAGCGTCGCCG-3¢ ... 5¢-CGAATCCCTACCCCAAGATCTGAT CGGGCCTGAAGCGTCGCCG-3¢ and the reverse primer 5¢-CGGCGACGCTTCAGGCCCGATCAGATCTTGGGG TAGGGATTCG-3¢ were used. Briefly, the mutagenes...

Ngày tải lên: 16/03/2014, 00:20

... following counters: sentence(ST ) for the root ancestor’s ST , patter n i (ST ) for the ones complying to the i-th lexico-syntactic pattern and negative(ST ) for the other ancestors 1 . Clause detection. ... appealing characteristics. The re- cent availability of unsupervised syntactic parsers has offered an opportunity to conduct research on SRL, without reliance on supervised syntacti...

Ngày tải lên: 17/03/2014, 01:20

... loss, how it occurred, and who was responsible for the loss. Centres should use the JCQ form JCQ/LCW to inform AQA Candidate Services of the circumstances. Where special help which goes beyond ... of Centre is responsible to AQA for ensuring that coursework/portfolio work is conducted in accordance with AQA’s instructions and JCQ instructions. 6.2 Malpractice Teachers should inform c...

Ngày tải lên: 19/03/2014, 07:20