fi c ampli fi cation for il 10

Báo cáo khoa học: Ionizing radiation utilizes c-Jun N-terminal kinase for amplification of mitochondrial apoptotic cell death in human cervical cancer cells pptx

Báo cáo khoa học: Ionizing radiation utilizes c-Jun N-terminal kinase for amplification of mitochondrial apoptotic cell death in human cervical cancer cells pptx

... (Austin, TX, USA) A control siRNA (CCACTACCTGAGCACCCAG) speci c to the GFP DNA sequence was used as a negative control For transfection, cells were plated in 10 cm dishes at 50% confluency, and siRNA ... statistically significant (C) Effect of JNK inhibition on radiation-induced cytochrome c release HeLa cells were treated with 10 Gy of c- radiation in the presence or absence of the JNK-speci c inhibitor ... apoptogenic factors from the mitochondria into the cytosol [6,7] In contrast, anti-apoptotic members of the Bcl-2 family, such as Bcl-2, Bcl-xL, Bcl-w and Mcl–1 act primarily to preserve the mitochondrial...

Ngày tải lên: 07/03/2014, 05:20

13 370 0
Báo cáo khoa học: Modified PCR methods for 3¢ end amplification from serial analysis of gene expression (SAGE) tags doc

Báo cáo khoa học: Modified PCR methods for 3¢ end amplification from serial analysis of gene expression (SAGE) tags doc

... G or C Linker A: 5¢-TTTGGATTTGCTGGTGCAGTACAACTAGGCTTAATAGGGACATG-3¢ and 5¢-pTCCCT ATTAA GCCTAGTTGTACTGCACCAGCAAATCC-amino modified C7 -3¢ Linker B: 5¢-TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGGACATG-3¢ ... 5¢-AAGCAGTGGTATCAACGCAGAGTACGCGGG-3¢ PLF: 5¢-AAGCAGTGGTATCAACGCAGAGT-3¢ PLR: 5¢-CCAGACACTATGCTCATACGACG-3¢ Tag-speci c primer: 5¢-GGATCCCATGXXXXXXXXXX-3¢, where GGATCC is the BamHI site, and CATG(X )10 ... 5¢-(biotin)ATTGGCGCGCCGCGAGCACTGAGTCAATACGA(T)30VN-3¢ rSAGER1: 5¢-GCGAGCACTGAGTCAATACGA-3¢ rSAGEF1: 5¢-AAGCAGTGGTATCAACGCAGAGT-3¢ TSP (tag-speci c primer): See step Linker A1: 5¢-AAGCAGTGGTATCAACGCAGAGTCATG-3¢...

Ngày tải lên: 07/03/2014, 00:20

12 544 0
Báo cáo khoa học: "Joint Identification and Segmentation of Domain-Specific Dialogue Acts for Conversational Dialogue Systems" doc

Báo cáo khoa học: "Joint Identification and Segmentation of Domain-Specific Dialogue Acts for Conversational Dialogue Systems" doc

... right those for the utterances annotated with multiple dialogue acts Each dialogue act class typically contains several more speci c dialogue acts that include domain-speci c semantics (for example, ... 77 distinct labels, with each label corresponding to a domain-speci c dialogue act, including some semantic information Each of these 77 labels is composed at least of a core speech act type (e.g ... utterances in the dataset, and their dialogue act annotation We add word indices as subscripts in the utterances for illustration purposes only, to facilitate identi cation of the word spans for each...

Ngày tải lên: 07/03/2014, 22:20

6 354 0
Báo cáo khoa học: Cholinoceptive and cholinergic properties of cardiomyocytes involving an amplification mechanism for vagal efferent effects in sparsely innervated ventricular myocardium ppt

Báo cáo khoa học: Cholinoceptive and cholinergic properties of cardiomyocytes involving an amplification mechanism for vagal efferent effects in sparsely innervated ventricular myocardium ppt

... 5¢-ACAAGGAAGGATAGTGAAGCC-3¢; m2 (reverse), 5¢-CATCTCCATTCTGACCTGAAG-3¢; m5 (forward), 5¢-TCTGTTCAGATCCTGCTTG-3¢; m5 (reverse), 5¢-TGCTGGAGACAGAAGGTAGT-3¢; a3 (forward), 5¢CAGAGTCCAAAGGCTGCAAG-3¢; a3 (reverse), ... AGAGGGACAGCACAGCAT-3¢; a4 (forward), 5¢-CT CACCGTCCTTCTGTGTC-3¢; and a4 (reverse), 5¢-CT GGCTTTCTCAGCTTCCAG-3¢ Protein preparation and immunoblotting The protein from confluent rat cultured cardiomyocytes ... novel mechanism for a direct action of vagally released ACh on the ventricular cardiomyocytes, i.e ampli cation of the vagal effect via ACh-induced ACh production in cardiomyocytes This mechanism...

Ngày tải lên: 23/03/2014, 05:22

15 386 0
báo cáo hóa học:" Research Article Mixed-Signal Architectures for High-Efficiency and Low-Distortion Digital Audio Processing and Power Amplification" doc

báo cáo hóa học:" Research Article Mixed-Signal Architectures for High-Efficiency and Low-Distortion Digital Audio Processing and Power Amplification" doc

... modulator for high-fidelity digital audio ampli er,” in Proceedings of the IEEE International Conference on Electronics, Circuits, and Systems (ICECS ’06), pp 830–833, Nice, France, 2006 [13] C Pascual, ... Feedback type comparison, power efficiency versus Pout Figure 8: THD reduction for different analog LC filter types 0.8 THD (%) and 10 for the ampli er nicknamed A2 refer to a feedback configuration ... devices As example the processing part of the ampli er occupies 90% of a Xilinx Virtex XCV100 or 58% of a Xilinx Spartan3 200 Such devices are available for large volume production at a cost...

Ngày tải lên: 21/06/2014, 20:20

11 360 0
Designation: C 22/C 22M – 00 - Standard Specification for Gypsum1 doc

Designation: C 22/C 22M – 00 - Standard Specification for Gypsum1 doc

... incorporated since the last issue Committee C- 11 has identified those changes that affect the technical interpretation or use of the speci cation (1) Section 9.1 was revised The American Society ... in the carrier NOTE 1—State law may require additional information 12 Keywords 12.1 calcium sulfate; gypsum SUMMARY OF CHANGES This section identifies the location of changes to this speci cation ... C 22 /C 22M 11.2.3 Net or gross weights, or both, of the package 11.3 When shipped in bulk, a card containing the required information in accordance with 11.2 shall be conspicuously placed...

Ngày tải lên: 10/07/2014, 23:20

2 385 0
Designation: C 475 – 94 Standard Specification for Joint Compound and Joint Tape for Finishing docx

Designation: C 475 – 94 Standard Specification for Joint Compound and Joint Tape for Finishing docx

... panel shall contain the word“ 10 Keywords 10. 1 all-purpose compound; bond; check cracking; dimensional stability; edge cracking; finishing compound; joint compound; joint tape; putrefaction; shrinkage; ... Headquarters Your comments will receive careful consideration at a meeting of the responsible technical committee, which you may attend If you feel that your comments have not received a fair hearing ... shrinkage; taping compound; tensile strength; topping compound The American Society for Testing and Materials takes no position respecting the validity of any patent rights asserted in connection with...

Ngày tải lên: 10/07/2014, 23:20

2 248 0
Designation: C 630/C 630M – 00 - Standard Specification for docx

Designation: C 630/C 630M – 00 - Standard Specification for docx

... under the specified width Sampling, Inspection, Rejection, Certi cation, Packaging, Marking, Shipping, Handling, and Storage 8.1 Sampling, Inspection, Rejection, Certi cation, Packaging, Marking, ... and covered with another coat of joint compound All screw heads in the face layer shall be covered with two coats of joint compound SUMMARY OF CHANGES Committee C- 11 has identified the location ... studs complying with Speci cation C 645, spaced 24 in [ 610 mm] on center The 48 in [1220 mm] wide base layer shall be attached using in [25 mm] long drywall screws spaced 12 in [305 mm] on center...

Ngày tải lên: 10/07/2014, 23:20

3 179 0
Designation: C 595 – 00ae1 - Standard Specification for Blended Hydraulic Cements1 pps

Designation: C 595 – 00ae1 - Standard Specification for Blended Hydraulic Cements1 pps

... Portland Cement—See Terminology C 219 For purposes of this speci cation, portland cement meeting the requirements of Speci cation C 1157 or Speci cation C 150 are suitable Portland cement or ... airtight containers for 27 days at 38 C 1.7 C Cool to 23 C 1.7 C before testing 10. 1.17 Sulfate Resistance—Test Method C 101 2 14 Certi cation 14.1 At the request of the purchaser, the manufacturer ... accordance with Test Method C 109 /C 109 M A1.4 Calculation A1.4.1 Calculate the pozzolanic activity index with portland cement as follows: Pozzolanic activity index with portland cement ~A/B! 100 ...

Ngày tải lên: 10/07/2014, 23:20

7 225 0
Designation: C 602 – 95a - Standard Specification for Agricultural Liming Materials1 pdf

Designation: C 602 – 95a - Standard Specification for Agricultural Liming Materials1 pdf

... as-received basis Calculate as follows: 13 Keywords C. C.E ~as2received! @12~% moisture 100 !# C. C.E ~oven2dry! (1) 13.1 agricultural liming materials; agricultural limestone; burnt lime; calcium carbonate ... percentage point 12 Report 12.1 Report the following results for agricultural liming materials: 12.1.1 Percentage Calcium Carbonate Equivalent—The percentage calcium carbonate equivalent (C. C.E.) ... Bags—Proceed as in 8.1.2.2 Chemical Methods 9.1 Reagent grade chemicals or equivalent and water purity shall be used as specified in Test Methods C 25 9.2 The analytical sample for chemical methods...

Ngày tải lên: 10/07/2014, 23:20

3 218 0
Báo cáo y học: "α Impact of VIP and cAMP on the regulation of TNF-α and IL-10 production: implications for rheumatoid arthritis" pps

Báo cáo y học: "α Impact of VIP and cAMP on the regulation of TNF-α and IL-10 production: implications for rheumatoid arthritis" pps

... the action of adenylate cyclase converting ATP to cAMP Intracellular cAMP was measured using a colorimetric direct immunoassay in accordance with the manufacturer’s instructions Briefly, × 105 ... detected in a variety of cell types including mast cells, neutrophils, and mononuclear cells The effects of VIP are transduced via three known receptors, VPAC1, VPAC2, and PAC1, all of which are ... relatively little effect on IL- 10 production by RASMCs (Fig 7c, d) Dibutyryl cAMP suppressed spontaneous TNF-α production by 36% and 46% at concentrations of 100 and 100 0 µM, respectively (IC50 = 20 µM)...

Ngày tải lên: 09/08/2014, 01:23

12 413 0
Essential C# 3.0 FOR NET FRAMEWORK 3.5 PHẦN 10 ppt

Essential C# 3.0 FOR NET FRAMEWORK 3.5 PHẦN 10 ppt

... at execution time, converting the CIL to machine code the processor can understand Conversion to machine code is still not sufficient for code execution, however It is also necessary for a C# program ... writing, including versions of COBOL and FORTRAN) Languages that compile to the CIL are source languages and each has a custom compiler that converts the source language to the CIL Once compiled to ... standards C# Compilation to Machine Code The HelloWorld program listing from Chapter is obviously C# code, and you compiled it for execution using the C# compiler However, the processor still cannot...

Ngày tải lên: 12/08/2014, 16:22

91 459 0
Practical Statecharts in C/C++ Quantum Programming for Embedded Systems phần 10 pptx

Practical Statecharts in C/C++ Quantum Programming for Embedded Systems phần 10 pptx

... METHODS Calc *CalcCtor(Calc *me); void CalcXtor(Calc *me); END_CLASS /* the calculator window handle */ Exercise A.5 Provide definition of the Calc class constructor CalcCtor() and the destructor CalcXtor() ... [1] A copy of Adobe Acrobat Reader™ is included on the CD−ROM for your convenience Appendix C: CD−ROM 265 C. 1 Source Code Structure The structure of the source code on the disc does not strictly ... each object can easily add up to something significant The run−time cost of virtual call dispatching (dynamic binding) in "C+ " is similar to C+ + In fact, most compilers generate identical code...

Ngày tải lên: 12/08/2014, 21:21

35 603 0
TCP/IP Sockets in C# Practical Guide for Programmers phần 10 ppt

TCP/IP Sockets in C# Practical Guide for Programmers phần 10 ppt

... WSAINVALIDPROCTABLE WSAINVALIDPROVIDER WSAPROVIDERFAILEDINIT WSASYSCALLFAILURE 100 38 100 39 100 40 100 41 100 42 100 43 100 44 100 45 100 46 100 47 100 48 100 49 100 50 100 51 100 52 100 53 100 54 100 55 100 56 100 57 100 58 ... cycle of, 155–165 performance of, 154–155 UDP sockets vs., 29 TcpClient, 16, 21–23 TcpClientShutdown, 140–141 TcpEchoClient, 17–23 TcpEchoClientAsync, 120–125 TcpEchoClientSocket, 37–39 TcpEchoServer, ... 24–26 TcpEchoServerAsync, 125–131 TcpEchoServerSelectSocket, 96–99 TcpEchoServerSocket, 40–50 TcpEchoServerThread, 108 109 TcpEchoServerTimeout, 89–92 TcpListener, 16, 26–27 TcpListenerAcceptSocket,...

Ngày tải lên: 13/08/2014, 08:21

17 696 0
Báo cáo y học: "Functional relevance of IL-10 promoter polymorphisms for sepsis development" docx

Báo cáo y học: "Functional relevance of IL-10 promoter polymorphisms for sepsis development" docx

... Stanilova Critical Care 2 010, 14:119 http://ccforum.com/content/14/1/119 susceptibility to severe sepsis – in contrast to the other two linked IL- 10 polymorphisms (–592 and ... analysis Crit Care 2007, 11:R49 Shu Q, Fang X, Chen Q, Stuber F: IL- 10 polymorphism is associated with increased incidence of severe sepsis Chin Med J (Engl) 2003, 116:1756-1759 doi :10. 1186/cc8839 Cite ... and subsequently developing bacterial sepsis and MODS The concentration of IL- 10 in the blood – in most respects, lipopolysaccharide-induced IL- 10 – is indicative for the magnitude of the inflammatory...

Ngày tải lên: 13/08/2014, 20:21

2 153 0
Visual C# Game Programming for Teens phần 10 docx

Visual C# Game Programming for Teens phần 10 docx

... compiled it yourself or just copied it from the chapter resource files, create a new C# project Then, open the Project menu and select Add Reference Locate the LuaInterface.dll file and select ... ’System.InvalidOperationException’ occurred in Lua Script Demo.exe Additional information: An error occurred creating the form See Exception.InnerException for details The error is: Could not load file or assembly ... 232 loading files, 242–259 NPCs (non-player characters), 18 player characters (PCs), 298–301 templates, 298–304 circular collisions, 64 Civilization, 6, 153 classes, 3, 43 base character, 232–237...

Ngày tải lên: 14/08/2014, 01:20

40 300 0
10 c language tips for engineers

10 c language tips for engineers

... engineer can look for that nine times out of ten is the culprit a Watch out for missing #include files This can result in the developer looking at a perfectly good line of code but because the necessary ... header files aren’t included the compiler flags it as error, indicating that something is not defined b Watch for missing semicolons One of the most common errors when writing C code is to forget ... necessary to optimize how quickly a decision is made to boot the application or the boot-loader In this case assembly code for the branch decision may make sense Another, is when developing a control...

Ngày tải lên: 18/09/2016, 22:43

8 321 0
C++ Basics - Functions for All Subtasks

C++ Basics - Functions for All Subtasks

... Slide 5- 24 Functions Calling Functions  A function body may contain a call to another function  The called function declaration must still appear before it is called   Functions cannot be defined ... Pearson Education, Inc Publishing as Pearson Addison-Wesley Slide 5- 16 Call Comparisons Call By Reference vs Value  Call-by-reference  The function call: f(age); Call-by-value  The function call: ... interchanged Copyright © 2007 Pearson Education, Inc Publishing as Pearson Addison-Wesley Slide 5- 27 Function celsius  Preconditions and postconditions make the declaration for celsius: double celsius(double...

Ngày tải lên: 12/09/2012, 22:49

65 477 0
ENGLISH 45  MINUTES TEST FOR THE 10th FORM      NO 102

ENGLISH 45 MINUTES TEST FOR THE 10th FORM NO 102

... keys ENGLISH 45 MINUTES TEST FOR THE 10th FORM NO 102 Full name:…………………………………………….class:10A…… I Read the text below and choose the correct word / phrase for each space.(1,5m) English is a very ... then I watched TV A I had done my homework before I watched TV B I did my homework before I had watched TV C I did my homework before I watched TV D I had done my homework before I had watched TV ... homework before I watched TV C I had done my homework before I watched TV D I had done my homework before I had watched TV _The End _ ENGLISH 45 MINUTES TEST FOR THE 10th FORM NO 104 Full name:…………………………………………….class:10A……...

Ngày tải lên: 11/04/2013, 20:07

8 3K 10
Giáo án học kỳ 2 Khối 10

Giáo án học kỳ 2 Khối 10

... niệm C ng c ng suất vận dụng c ng c ng suất : C c đơn vò c ng c ng suất , giải thích t c dụng hộp số xe máy - Kỹ : Vận dụng C ng c ng suất vào tập - Tư : Phương pháp nghiên c u vận dụng c ch th c ... l c, vận t c thông qua hộp số 4/ C ng c – Dặn dò: Bài 43: C NG C A TRỌNG L C ĐỊNH LUẬT BẢO TOÀN C NG I M c đích – yêu c u: Nguyễn Thò Kim Dung Giáo án lớp 10 H c kỳ II - Kiến th c : Tính c ng ... mà vật c chuyển động b/ Biểu th c: Xét ví dụ sau: Đẩy cho xe lăn với vận t c v, dây c ng ra, kh c gỗ bắt đầu chuyển động, xe th c lên kh c gỗ c ng h c A = - T.s (T: L c căng dây) Mặt kh c : s...

Ngày tải lên: 03/06/2013, 01:26

20 634 0
w