Everyone is a customer pot
... business is not easily quantified and controlled. This lack of analytical mechanisms puts collaborative relationships at risk. ❚ The lack of analytical mechanisms puts collaborative rela- tionships at ... to achieve shared goals and the benefit from doing so. THE NEED TO COLLABORATE It is the new business mantra—collaborate, collaborate, collab- orate. But what is collaboration and why...
Ngày tải lên: 28/06/2014, 00:20
... relationship based as opposed to transaction based, it is not easily quantified and controlled. This lack of analytical mechanisms puts collaborative relationships at risk. 1 ❘ The Collaboration Imperative ... to achieve shared goals and the benefit from doing so. THE NEED TO COLLABORATE It is the new business mantra—collaborate, collaborate, collab- orate. But what is collaboration and...
Ngày tải lên: 28/06/2014, 08:20
... to achieve shared goals and the benefit from doing so. THE NEED TO COLLABORATE It is the new business mantra—collaborate, collaborate, collab- orate. But what is collaboration and why is everyone ... to have satisfied. All are hits and the connection is personal. 22 Part One ❘ The Era of Collaborative Business sumers. But in a Collaborative Community, value is exchanged between...
Ngày tải lên: 28/06/2014, 22:20
A Slave is a Slave pot
... washed his hands. Metaphorically, he did so at that moment; thereafter his interest in Adityan affairs was that of a spectator at a boring and stupid show, watching only because there is nothing ... chartered Zarathustra Company had it all their way. Their charter was for a Class III uninhabited planet, which Zarathustra was, and it meant they owned the planet lock stock and barrel. T...
Ngày tải lên: 29/03/2014, 16:20
Pitch and Throw, Grasp and Know: What Is a Synonym? pot
... ILLUSTRATOR BRIAN P. CLEARY is the author of the Words Are Categorical series, including A Mink, a Fink, a Skating Rink: What Is a Noun? and Hairy, Scary, Ordinary: What Is an Adjective?, and of Rainbow ... what is a synonym? / by Brian P. Cleary; illustrated by Brian Gable. p. cm. — (Words are categorical) eISBN: 1-57505-907-X 1. English language—Synonyms and antonyms—Juve...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Zhao Z, Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM. A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral ... the manufac- turer’s procedure (Clontech, CA). Briefly, mouse Vgf cDNA (Salton, unpublished data) was isolated via Xba I-Apa I restriction cleavage, and cloned into the NheI-ApaI sites o...
Ngày tải lên: 03/11/2012, 10:52
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... black dots, protease cleavage sites. (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose. (C) SDS ⁄ PAGE and silver stain ... charged plates and incubated with various concentrations of FN3d–AP supernatant. Binding of FN3d– AP was determined by alkaline phosphatase (AP) activity measured at 405 nm. The reaction rate ......
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT p21 WAF1/CIP1 Cyclin-dependent ... inverted terminal repeat amplification were: 1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC ATGGC-3¢; and AAV65MGB/taq, 5¢-G...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx
... (AAC71532) and with the putative triacylglycerol lipase AAB96044 from Mycoplasma pneumoniae (Mp). Identical amino acids are indicated by an asterisk and similar amino acids are indi- cated by a colon and ... Woolford CA, Noble JA, Garman JD, Tam MF, Innis MA & Jones EW (1993) Phenotypic analysis of protein- ase A mutants. Implications for autoactivation and the maturation pathway of t...
Ngày tải lên: 07/03/2014, 05:20