The Environment in Anthropology - A Reader in Ecology, Culture, and Sustainable Living pot
The Environment in Anthropology - A Reader in Ecology, Culture, and Sustainable Living pot
... Slash -and- burn farming in tropical rain forests requires compara- tively little co-operation in that a few men clear the land after which their wives plant and cultivate the crops. Dry farming may ... G. M. Van Dyne. New York: Academic Press. Sweet, L. 1965. Camel Pastoralism in N. Arabia and the Minimal Camping Unit. Man, Culture, and Animals. Edited by A. Leeds and...
Ngày tải lên: 27/06/2014, 16:20
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... http://mips.gsf.de/proj/ yeast/info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, ... disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAA...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot
... was obtained from Oriental Yeast Co. (Lot 21003805) (Osaka, Japan) and proCPY was prepared as the same manner as CPY, with minor modifications. Dgly CPY and Dgly proCPY, in which the asparagine ... between the heat- and pressure-unfold- ing of CPY described above may be due to its two domains (the b-sheet-rich and the helix-rich domains [9]) (Fig.4).ThefactthataDSCpeakofCPYw...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
... 6: The graph of micro-average F -measure against the number of training sentences during text chunking (A: MHHMM, B: HHMM and C: HMM) The first finding is that the size of training data dramatically ... The second dataset is part of the Lancaster Treebank corpus and contains 1473 sentences. Each sentence con- tains hand-labeled syntactic roles for natural lan- guage text. A. 20...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: " The Signal System in Interlingua — A Factor in Mechanical Translation" potx
... Russian balalaika and a resonant Spanish guitar, and so forth make fascinating material for descriptive and analytical studies in some branch of meta- linguistics. But no fundamental research ... translation and of mechanical translation in par- ticular is not that the signal system of departure language and target language be complete in any absolute sense of the...
Ngày tải lên: 16/03/2014, 19:20
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
... of the glyoxalase pathway as a potential therapeutic target by revealing the importance of critical parameters of this pathway in Leishma- nia infantum. A sensitivity analysis of the pathway was ... methylglyoxal was measured in L. infantum (100 lL extract) with a specific HPLC-based assay, by deri- vatization with 1,2-diaminobenzene and using 2,3-dimethyl- quinoxaline as int...
Ngày tải lên: 23/03/2014, 13:20
on the shoulders of giants a course in single variable calculus - smith & mcleland
... function. In contrast to local extreme values, we can also consider global or absolute maxima and minima. A function is said to have a global maximum at in its domain if for all in the domain of .Itissaidtohavea global ... open intervals. If has a local extreme value at a point in its domain, then either or does not exist. A stationary point of a function is a point...
Ngày tải lên: 31/03/2014, 15:40
The History of England A Study in Political Evolution ppt
... founded at Singapore and on the Malay Peninsula. In India itself Tippoo was defeated and slain in his capital at Seringapatam in 1799, the Mahrattas were crushed at Assye and Argaum in 1803, the nabob ... massacred their enemies to a man, if not also to a woman and child. Massacre there certainly was at Anderida and other places taken by storm, and no doubt whole...
Ngày tải lên: 31/03/2014, 21:20
the retreat of reason a dilemma in the philosophy of life dec 2005
... quality and location, the pain that was present before the amputation Thus, a patient who was suffering from a wood sliver jammed under a finger nail, and at the same time lost his hand in an accident, ... unpleasant smells and tastes? To answer this question we have to take note of a difference between seeing and hearing, on the one hand, and smelling and tasting...
Ngày tải lên: 11/06/2014, 10:39
Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot
... CTC-ATG-GGG- GCT-CAA-AGG-AAC-TAG-GAG-ATC-GG-3’)andR (5’GGG-GCT-GGA-CCA-ACA-CAC-GTC-CTT-GGG-3’) in all subjects with monoallelic mutation in the coding region of GJB2, 262 unrelated nonsyndromic hearing loss ... GJB6 g ene deletions. The coding exon of GJB6 was amplified with the primers F (5’ TTG-GCT-TCA-GTC-TGT-AAT-ATC-ACC-3’ )and R(5’ TCA-TTT-ACA- AAC-TCT- TCA-GGC -TAC -AG- 3’ )....
Ngày tải lên: 18/06/2014, 16:20