Báo cáo hóa học: " A Robust Color Object Analysis Approach to Efficient Image Retrieval" pdf

Báo cáo hóa học: "A Two-Step Hydrothermal Synthesis Approach to Monodispersed Colloidal Carbon Spheres" pdf

Báo cáo hóa học: "A Two-Step Hydrothermal Synthesis Approach to Monodispersed Colloidal Carbon Spheres" pdf

... potential applications, including high-density and high-strength carbon artifacts lithium storing materials [4–8], sacrificial template to fabricate hollow structures [9–16], catalyst support material ... the sealed autoclave was heated to 180 °C for 4 h along with constant stirring at *800 rpm, and then cooled to room temperature naturally. Finally, the suspension containing the as-prep...

Ngày tải lên: 21/06/2014, 20:20

6 269 0
Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot

Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot

... diagonal elements of R η . Hence, the MAI covariance matrix R η can be approximated as a block diagonal matrix and the block that appears in its main diagonal is given by (A. 4).Notethatsuchanapprox- imation ... MAI can be treated as a stochastic random pro- cess [16]. Specifically, MAI vector η can be modelled as a zero mean Gaussian vector with covariance matrix R η = E[ηη H ]. Since t...

Ngày tải lên: 22/06/2014, 22:20

12 438 0
Báo cáo hóa học: " A Robust on-Demand Path-Key Establishment Framework via Random Key Predistribution for Wireless Sensor " doc

Báo cáo hóa học: " A Robust on-Demand Path-Key Establishment Framework via Random Key Predistribution for Wireless Sensor " doc

... Texas at Dallas. Her research in- terest is mainly in database systems, espe- cially in spatial database with applications in geographic information systems and bioinformatics, distributed database ... Optimization and an Editor of the research monograph Clustering and Information Re- trieval. She is an Associate Editor of KAIS: An International Jour- nal on Knowledge and Information Systems...

Ngày tải lên: 22/06/2014, 22:20

10 247 0
Báo cáo hóa học: " A Robust Capon Beamformer against Uncertainty of Nominal Steering Vector" pdf

Báo cáo hóa học: " A Robust Capon Beamformer against Uncertainty of Nominal Steering Vector" pdf

... shows that the proposed RCB can be generalized as a diagonal loading approach. The diagonal loading factor is calculated from the constraint equation. In this paper, we derive the optimal output ... source on a far-field steering Applebaum array- two dimensional array case,” IEEE Transactions on Antennas and Propagation, vol. 36, no. 4, pp. 468–475, 1988. [6] S. A es and Y. Grenier, A s...

Ngày tải lên: 22/06/2014, 23:20

8 221 0
Báo cáo hóa học: " A Robust Formant Extraction Algorithm Combining Spectral Peak Picking and Root Polishing" potx

Báo cáo hóa học: " A Robust Formant Extraction Algorithm Combining Spectral Peak Picking and Root Polishing" potx

... accuracy by adjusting the tolerance in (6). If the ap- plication requires more accuracy, then we need to adopt a smaller value for ε.Anε value of 10 −4 is generally suitable for reliably obtaining ... extractors based on roots solving. This integration is performed in the vicinity of the peak. Let’s assume that the angle related to the spectral peak is φ PEAK . The area that we want to...

Ngày tải lên: 22/06/2014, 23:20

16 270 0
Báo cáo hóa học: " A Posterior Union Model with Applications to Robust Speech and Speaker Recognition" pot

Báo cáo hóa học: " A Posterior Union Model with Applications to Robust Speech and Speaker Recognition" pot

... for each frame, with the same band limitation and cepstral mean subtraction. All models used 32 Gaussian mixtures with diagonal covariance matrices for each spe aker. 6 EURASIP Journal on Applied ... (similar to cepstral mean removal) and with the addition of the delta vector, was used in the experiments. Thus, there was a feature vector of twelve streams, six static and six dynamic, for...

Ngày tải lên: 22/06/2014, 23:20

12 323 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo ... (’ 5to3 ’) SEA M18970 cttgtacatatgagcgagaaaagcgaagaa gcgcggatccttaacttgtatataaata SED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaat...

Ngày tải lên: 18/06/2014, 16:20

9 568 0
báo cáo hóa học: " A case study on co-exposure to a mixture of organic solvents in a Tunisian adhesive-producing company" potx

báo cáo hóa học: " A case study on co-exposure to a mixture of organic solvents in a Tunisian adhesive-producing company" potx

... data collection, data analysis, data interpretation, manuscript writing, and final approval of manuscript. CN was involved in the conception and design of the study and data interpretation. AL ... Environ Health 1996, 68:88-93. 26. Baldasseroni A, Bavazzano P, Buiatti E, Lanciotti E, Lorini C, Biggeri A: Occupational exposure to n-hexane in Italy, analysis of a registry of biologica...

Ngày tải lên: 20/06/2014, 00:20

8 642 0
Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx

Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx

... they are cheap in general, commercially available, air stable crystalline solids, safe, and non-toxic, hence easy to handle. Results: Carbonyl compounds (aliphatic, heterocyclic, and aromatic) ... Surface area of the catalyst before and after use in the reaction was mea- sured using surface area & pore size analyzer (NOVA 1000e, Quanta chrome Instruments). All the chemicals were used as...

Ngày tải lên: 20/06/2014, 22:20

6 591 1
Báo cáo hóa học: "A REMARK ON kTH-ORDER LINEAR FUNCTIONAL EQUATIONS WITH CONSTANT COEFFICIENTS" pdf

Báo cáo hóa học: "A REMARK ON kTH-ORDER LINEAR FUNCTIONAL EQUATIONS WITH CONSTANT COEFFICIENTS" pdf

... WITH CONSTANT COEFFICIENTS JITKA LAITOCHOV ´ A Received 30 January 2006; Accepted 18 May 2006 Abel functional equations are associated to a linear homogeneous functional equation with constant coefficients. ... Laitochov ´ a: Mathematical Department, Faculty of Education, Palack ´ y University, ˇ Zi ˇ zkovo n ´ am ˇ esti 5, Olomouc 77140, Czech Republic E-mail address: jitka.laitochova@u...

Ngày tải lên: 22/06/2014, 22:20

8 331 0
w